Genomics Reporting Implementation Guide
3.0.1-SNAPSHOT - Ballot International flag

Genomics Reporting Implementation Guide, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 3.0.1-SNAPSHOT built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/genomics-reporting/ and changes regularly. See the Directory of published versions

: bundle-CG-IG-HLA-FullBundle-01 - XML Representation

Raw xml | Download



<Bundle xmlns="http://hl7.org/fhir">
  <id value="bundle-CG-IG-HLA-FullBundle-01"/>
  <type value="transaction"/>
  <entry>
    <fullUrl value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
    <resource>
      <Patient>
        <id value="CG-IG-HLA-FullBundle-01-1"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Patient_CG-IG-HLA-FullBundle-01-1"> </a><p class="res-header-id"><b>Generated Narrative: Patient CG-IG-HLA-FullBundle-01-1</b></p><a name="CG-IG-HLA-FullBundle-01-1"> </a><a name="hcCG-IG-HLA-FullBundle-01-1"> </a><a name="CG-IG-HLA-FullBundle-01-1-en-US"> </a><p style="border: 1px #661aff solid; background-color: #e6e6ff; padding: 10px;">John Storm(official) Male, DoB: 1986-12-31 ( Donor Registration Number (use: usual, period: 2012-11-10 --&gt; (ongoing)))</p><hr/></div>
        </text>
        <identifier>
          <use value="usual"/>
          <type>
            <coding>
              <system value="http://terminology.hl7.org/CodeSystem/v2-0203"/>
              <code value="DR"/>
            </coding>
          </type>
          <system value="urn:oid:0.0.0.0.0.0.0"/>
          <value value="12345"/>
          <period>
            <start value="2012-11-10"/>
          </period>
          <assigner>
            <display value="aDonorRegistry"/>
          </assigner>
        </identifier>
        <name>
          <use value="official"/>
          <text value="John Storm"/>
          <family value="Storm"/>
          <given value="John"/>
        </name>
        <name>
          <use value="nickname"/>
          <text value="Johnny Storm"/>
          <family value="Storm"/>
          <given value="Johnny"/>
        </name>
        <name>
          <use value="nickname"/>
          <text value="The Human Torch"/>
        </name>
        <gender value="male"/>
        <birthDate value="1986-12-31"/>
      </Patient>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Patient"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
    <resource>
      <Specimen>
        <id value="CG-IG-HLA-FullBundle-01-2"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Specimen_CG-IG-HLA-FullBundle-01-2"> </a><p class="res-header-id"><b>Generated Narrative: Specimen CG-IG-HLA-FullBundle-01-2</b></p><a name="CG-IG-HLA-FullBundle-01-2"> </a><a name="hcCG-IG-HLA-FullBundle-01-2"> </a><a name="CG-IG-HLA-FullBundle-01-2-en-US"> </a><p><b>identifier</b>: <code>http://myorgsurl.com</code>/123</p><p><b>accessionIdentifier</b>: <code>http://mylabsurl.com</code>/456</p><p><b>type</b>: <span title="Codes:{http://snomed.info/sct 122555007}">Venous blood specimen</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p></div>
        </text>
        <identifier>
          <system value="http://myorgsurl.com"/>
          <value value="123"/>
        </identifier>
        <accessionIdentifier>
          <system value="http://mylabsurl.com"/>
          <value value="456"/>
        </accessionIdentifier>
        <type>
          <coding>
            <system value="http://snomed.info/sct"/>
            <code value="122555007"/>
            <display value="Venous blood specimen"/>
          </coding>
        </type>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
      </Specimen>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Specimen"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
    <resource>
      <Organization>
        <id value="CG-IG-HLA-FullBundle-01-3"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Organization_CG-IG-HLA-FullBundle-01-3"> </a><p class="res-header-id"><b>Generated Narrative: Organization CG-IG-HLA-FullBundle-01-3</b></p><a name="CG-IG-HLA-FullBundle-01-3"> </a><a name="hcCG-IG-HLA-FullBundle-01-3"> </a><a name="CG-IG-HLA-FullBundle-01-3-en-US"> </a><p><b>name</b>: aTypingLab Inc</p><p><b>alias</b>: aTL</p><p><b>telecom</b>: ph: 1-800-555-1234(Work)</p><p><b>address</b>: 123 Main St, Sometown, ND 99999(work)</p></div>
        </text>
        <name value="aTypingLab Inc"/>
        <alias value="aTL"/>
        <telecom>
          <system value="phone"/>
          <value value="1-800-555-1234"/>
          <use value="work"/>
          <rank value="1"/>
        </telecom>
        <address>
          <use value="work"/>
          <type value="both"/>
          <text value="123 Main St, Sometown, ND 99999"/>
          <line value="123 Main St"/>
          <city value="Sometown"/>
          <state value="ND"/>
          <postalCode value="99999"/>
          <country value="USA"/>
        </address>
      </Organization>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Organization"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5"/>
    <resource>
      <Organization>
        <id value="CG-IG-HLA-FullBundle-01-4"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Organization_CG-IG-HLA-FullBundle-01-4"> </a><p class="res-header-id"><b>Generated Narrative: Organization CG-IG-HLA-FullBundle-01-4</b></p><a name="CG-IG-HLA-FullBundle-01-4"> </a><a name="hcCG-IG-HLA-FullBundle-01-4"> </a><a name="CG-IG-HLA-FullBundle-01-4-en-US"> </a><p><b>name</b>: aDonorRegistry</p><p><b>alias</b>: ADR</p><p><b>telecom</b>: ph: 1-800-555-6789(Work)</p><p><b>address</b>: 456 Main St, Anytown ND, 00000(work)</p></div>
        </text>
        <name value="aDonorRegistry"/>
        <alias value="ADR"/>
        <telecom>
          <system value="phone"/>
          <value value="1-800-555-6789"/>
          <use value="work"/>
          <rank value="1"/>
        </telecom>
        <address>
          <use value="work"/>
          <type value="both"/>
          <text value="456 Main St, Anytown ND, 00000"/>
          <line value="456 Main St"/>
          <city value="Anytown"/>
          <state value="ND"/>
          <postalCode value="00000"/>
          <country value="USA"/>
        </address>
      </Organization>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Organization"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea"/>
    <resource>
      <ServiceRequest>
        <id value="CG-IG-HLA-FullBundle-01-5"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="ServiceRequest_CG-IG-HLA-FullBundle-01-5"> </a><p class="res-header-id"><b>Generated Narrative: ServiceRequest CG-IG-HLA-FullBundle-01-5</b></p><a name="CG-IG-HLA-FullBundle-01-5"> </a><a name="hcCG-IG-HLA-FullBundle-01-5"> </a><a name="CG-IG-HLA-FullBundle-01-5-en-US"> </a><p><b>status</b>: Completed</p><p><b>intent</b>: Order</p><p><b>code</b>: <span title="Codes:{http://loinc.org 13303-3}">HLA-A+B+C (class I) [Type]</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>authoredOn</b>: 2016-11-15</p><p><b>requester</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-00ef18ad-ed04-4b2c-81ee-b69bb243f0d5">aDonorRegistry</a></p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>reasonCode</b>: <span title="Codes:">tissue typing for donor registry</span></p></div>
        </text>
        <status value="completed"/>
        <intent value="order"/>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="13303-3"/>
            <display value="HLA-A+B+C (class I) [Type]"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <authoredOn value="2016-11-15"/>
        <requester>
          <reference value="urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5"/>
          <type value="Organization"/>
          <display value="aDonorRegistry"/>
        </requester>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <type value="Organization"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <reasonCode>
          <text value="tissue typing for donor registry"/>
        </reasonCode>
      </ServiceRequest>
    </resource>
    <request>
      <method value="POST"/>
      <url value="ServiceRequest"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-6"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-6"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-6</b></p><a name="CG-IG-HLA-FullBundle-01-6"> </a><a name="hcCG-IG-HLA-FullBundle-01-6"> </a><a name="CG-IG-HLA-FullBundle-01-6-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00001}">HLA-A*01:01:01:01</span></td><td>503</td><td>773</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00001"/>
            </coding>
            <text value="HLA-A*01:01:01:01"/>
          </referenceSeqId>
          <windowStart value="503"/>
          <windowEnd value="773"/>
        </referenceSeq>
        <observedSeq
                     value="GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-7"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-7"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-7</b></p><a name="CG-IG-HLA-FullBundle-01-7"> </a><a name="hcCG-IG-HLA-FullBundle-01-7"> </a><a name="CG-IG-HLA-FullBundle-01-7-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00001}">HLA-A*01:01:01:01</span></td><td>1014</td><td>1290</td></tr></table><p><b>observedSeq</b>: GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00001"/>
            </coding>
            <text value="HLA-A*01:01:01:01"/>
          </referenceSeqId>
          <windowStart value="1014"/>
          <windowEnd value="1290"/>
        </referenceSeq>
        <observedSeq
                     value="GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-8"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-8"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-8</b></p><a name="CG-IG-HLA-FullBundle-01-8"> </a><a name="hcCG-IG-HLA-FullBundle-01-8"> </a><a name="CG-IG-HLA-FullBundle-01-8-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00002}">HLA-A*01:02</span></td><td>503</td><td>773</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00002"/>
            </coding>
            <text value="HLA-A*01:02"/>
          </referenceSeqId>
          <windowStart value="503"/>
          <windowEnd value="773"/>
        </referenceSeq>
        <observedSeq
                     value="GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-9"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-9"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-9</b></p><a name="CG-IG-HLA-FullBundle-01-9"> </a><a name="hcCG-IG-HLA-FullBundle-01-9"> </a><a name="CG-IG-HLA-FullBundle-01-9-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00002}">HLA-A*01:02</span></td><td>1014</td><td>1290</td></tr></table><p><b>observedSeq</b>: GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00002"/>
            </coding>
            <text value="HLA-A*01:02"/>
          </referenceSeqId>
          <windowStart value="1014"/>
          <windowEnd value="1290"/>
        </referenceSeq>
        <observedSeq
                     value="GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-10"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-10"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-10</b></p><a name="CG-IG-HLA-FullBundle-01-10"> </a><a name="hcCG-IG-HLA-FullBundle-01-10"> </a><a name="CG-IG-HLA-FullBundle-01-10-en-US"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84414-2}">Haplotype name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-A*01:01:01G}">HLA-A*01:01:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-8200dab6-18a2-4550-b913-a7db480c0804">HLA-A*01:01:01:01, exon 2</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-7c393185-f15c-45bc-a714-c0fdbea32675">HLA-A*01:01:01:01, exon 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4931}">HLA-A</span></td></tr></table></div>
        </text>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84414-2"/>
            <display value="Haplotype name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
            <version value="3.23"/>
            <code value="HLA-A*01:01:01G"/>
            <display value="HLA-A*01:01:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804"/>
          <type value="MolecularSequence"/>
          <display value="HLA-A*01:01:01:01, exon 2"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675"/>
          <type value="MolecularSequence"/>
          <display value="HLA-A*01:01:01:01, exon 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4931"/>
              <display value="HLA-A"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-11"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-11"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-11</b></p><a name="CG-IG-HLA-FullBundle-01-11"> </a><a name="hcCG-IG-HLA-FullBundle-01-11"> </a><a name="CG-IG-HLA-FullBundle-01-11-en-US"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84414-2}">Haplotype name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-A*01:02}">HLA-A*01:02</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-65c85f14-c3a0-4b72-818f-820e04fcc621">HLA-A*01:02, exon 2</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-fbba9fe7-0ece-4ec1-9233-a437a8d242a0">HLA-A*01:02, exon 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4931}">HLA-A</span></td></tr></table></div>
        </text>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84414-2"/>
            <display value="Haplotype name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
            <version value="3.23"/>
            <code value="HLA-A*01:02"/>
            <display value="HLA-A*01:02"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621"/>
          <type value="MolecularSequence"/>
          <display value="HLA-A*01:02, exon 2"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0"/>
          <type value="MolecularSequence"/>
          <display value="HLA-A*01:02, exon 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4931"/>
              <display value="HLA-A"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-12"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-12"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-12</b></p><a name="CG-IG-HLA-FullBundle-01-12"> </a><a name="hcCG-IG-HLA-FullBundle-01-12"> </a><a name="CG-IG-HLA-FullBundle-01-12-en-US"> </a><p><b>basedOn</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84413-4}">Genotype display name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://glstring.org hla#3.23.0#HLA-A:01:01G+HLA-A*01:02}">hla#3.23.0#HLA-A:01:01G+HLA-A*01:02</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-b7765bbf-df40-486a-9f2f-404309643de6">HLA-A*01:01:01G, exons 2 and 3</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-d98d92a7-0e86-4ae5-b036-b7e1bba6ec32">HLA-A*01:02, exons 2 and 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4931}">HLA-A</span></td></tr></table></div>
        </text>
        <basedOn>
          <reference value="urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea"/>
          <type value="ServiceRequest"/>
          <display value="Class I HLA genotyping for John Storm"/>
        </basedOn>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84413-4"/>
            <display value="Genotype display name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://glstring.org"/>
            <version value="1.0"/>
            <code value="hla#3.23.0#HLA-A:01:01G+HLA-A*01:02"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6"/>
          <type value="Observation"/>
          <display value="HLA-A*01:01:01G, exons 2 and 3"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32"/>
          <type value="Observation"/>
          <display value="HLA-A*01:02, exons 2 and 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4931"/>
              <display value="HLA-A"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-13"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-13"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-13</b></p><a name="CG-IG-HLA-FullBundle-01-13"> </a><a name="hcCG-IG-HLA-FullBundle-01-13"> </a><a name="CG-IG-HLA-FullBundle-01-13-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00162}">HLA-B*15:01:01:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00162"/>
            </coding>
            <text value="HLA-B*15:01:01:01"/>
          </referenceSeqId>
          <windowStart value="486"/>
          <windowEnd value="756"/>
        </referenceSeq>
        <observedSeq
                     value="GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-14"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-14"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-14</b></p><a name="CG-IG-HLA-FullBundle-01-14"> </a><a name="hcCG-IG-HLA-FullBundle-01-14"> </a><a name="CG-IG-HLA-FullBundle-01-14-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00162}">HLA-B*15:01:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00162"/>
            </coding>
            <text value="HLA-B*15:01:01:01"/>
          </referenceSeqId>
          <windowStart value="1001"/>
          <windowEnd value="1277"/>
        </referenceSeq>
        <observedSeq
                     value="GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-15"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-15"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-15</b></p><a name="CG-IG-HLA-FullBundle-01-15"> </a><a name="hcCG-IG-HLA-FullBundle-01-15"> </a><a name="CG-IG-HLA-FullBundle-01-15-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00381}">HLA-B*57:01:01</span></td><td>485</td><td>755</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00381"/>
            </coding>
            <text value="HLA-B*57:01:01"/>
          </referenceSeqId>
          <windowStart value="485"/>
          <windowEnd value="755"/>
        </referenceSeq>
        <observedSeq
                     value="GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:db69e549-6267-4777-b4b9-8813f3329309"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-16"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-16"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-16</b></p><a name="CG-IG-HLA-FullBundle-01-16"> </a><a name="hcCG-IG-HLA-FullBundle-01-16"> </a><a name="CG-IG-HLA-FullBundle-01-16-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00381}">HLA-B*57:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00381"/>
            </coding>
            <text value="HLA-B*57:01:01"/>
          </referenceSeqId>
          <windowStart value="1001"/>
          <windowEnd value="1277"/>
        </referenceSeq>
        <observedSeq
                     value="GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-17"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-17"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-17</b></p><a name="CG-IG-HLA-FullBundle-01-17"> </a><a name="hcCG-IG-HLA-FullBundle-01-17"> </a><a name="CG-IG-HLA-FullBundle-01-17-en-US"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84414-2}">Haplotype name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HGG00041}">HLA-B*15:01:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-cbabf93e-1b4b-46f2-ba1e-d84862670670">HLA-B*15:01:01:01, exon 2</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-c233ad3d-1572-48d6-93da-0a583535e138">HLA-B*15:01:01:01, exon 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4932}">HLA-B</span></td></tr></table></div>
        </text>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84414-2"/>
            <display value="Haplotype name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
            <version value="3.23"/>
            <code value="HGG00041"/>
            <display value="HLA-B*15:01:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670"/>
          <type value="MolecularSequence"/>
          <display value="HLA-B*15:01:01:01, exon 2"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138"/>
          <type value="MolecularSequence"/>
          <display value="HLA-B*15:01:01:01, exon 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4932"/>
              <display value="HLA-B"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-18"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-18"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-18</b></p><a name="CG-IG-HLA-FullBundle-01-18"> </a><a name="hcCG-IG-HLA-FullBundle-01-18"> </a><a name="CG-IG-HLA-FullBundle-01-18-en-US"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84414-2}">Haplotype name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-B*57:01:01G}">HLA-B*57:01:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-05fa52d7-5c67-460a-8722-d3460b24d6fe">HLA-B*57:01:01, exon 2</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-db69e549-6267-4777-b4b9-8813f3329309">HLA-B*57:01:01, exon 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4932}">HLA-B</span></td></tr></table></div>
        </text>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84414-2"/>
            <display value="Haplotype name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
            <version value="3.23"/>
            <code value="HLA-B*57:01:01G"/>
            <display value="HLA-B*57:01:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe"/>
          <type value="MolecularSequence"/>
          <display value="HLA-B*57:01:01, exon 2"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:db69e549-6267-4777-b4b9-8813f3329309"/>
          <type value="MolecularSequence"/>
          <display value="HLA-B*57:01:01, exon 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4932"/>
              <display value="HLA-B"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-19"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-19"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-19</b></p><a name="CG-IG-HLA-FullBundle-01-19"> </a><a name="hcCG-IG-HLA-FullBundle-01-19"> </a><a name="CG-IG-HLA-FullBundle-01-19-en-US"> </a><p><b>basedOn</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84413-4}">Genotype display name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://glstring.org hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G}">hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e2092243-2970-49d2-a90f-b90d1d49715a">HLA-B*15:01:01G, exons 2 and 3</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-792be53e-d4fb-4887-a367-815ef6c706e5">HLA-B*57:01:01G, exons 2 and 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4932}">HLA-B</span></td></tr></table></div>
        </text>
        <basedOn>
          <reference value="urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea"/>
          <type value="ServiceRequest"/>
          <display value="Class I HLA genotyping for John Storm"/>
        </basedOn>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84413-4"/>
            <display value="Genotype display name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://glstring.org"/>
            <version value="1.0"/>
            <code value="hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a"/>
          <type value="Observation"/>
          <display value="HLA-B*15:01:01G, exons 2 and 3"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5"/>
          <type value="Observation"/>
          <display value="HLA-B*57:01:01G, exons 2 and 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4932"/>
              <display value="HLA-B"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-20"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-20"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-20</b></p><a name="CG-IG-HLA-FullBundle-01-20"> </a><a name="hcCG-IG-HLA-FullBundle-01-20"> </a><a name="CG-IG-HLA-FullBundle-01-20-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00401}">HLA-C*01:02:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00401"/>
            </coding>
            <text value="HLA-C*01:02:01"/>
          </referenceSeqId>
          <windowStart value="486"/>
          <windowEnd value="756"/>
        </referenceSeq>
        <observedSeq
                     value="GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-21"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-21"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-21</b></p><a name="CG-IG-HLA-FullBundle-01-21"> </a><a name="hcCG-IG-HLA-FullBundle-01-21"> </a><a name="CG-IG-HLA-FullBundle-01-21-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00401}">HLA-C*01:02:01</span></td><td>1002</td><td>1278</td></tr></table><p><b>observedSeq</b>: GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00401"/>
            </coding>
            <text value="HLA-C*01:02:01"/>
          </referenceSeqId>
          <windowStart value="1002"/>
          <windowEnd value="1278"/>
        </referenceSeq>
        <observedSeq
                     value="GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-22"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-22"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-22</b></p><a name="CG-IG-HLA-FullBundle-01-22"> </a><a name="hcCG-IG-HLA-FullBundle-01-22"> </a><a name="CG-IG-HLA-FullBundle-01-22-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00413}">HLA-C*03:04:01:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00413"/>
            </coding>
            <text value="HLA-C*03:04:01:01"/>
          </referenceSeqId>
          <windowStart value="486"/>
          <windowEnd value="756"/>
        </referenceSeq>
        <observedSeq
                     value="GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9"/>
    <resource>
      <MolecularSequence>
        <id value="CG-IG-HLA-FullBundle-01-23"/>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="MolecularSequence_CG-IG-HLA-FullBundle-01-23"> </a><p class="res-header-id"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-23</b></p><a name="CG-IG-HLA-FullBundle-01-23"> </a><a name="hcCG-IG-HLA-FullBundle-01-23"> </a><a name="CG-IG-HLA-FullBundle-01-23-en-US"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class="grid"><tr><td style="display: none">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00413}">HLA-C*03:04:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG</p></div>
        </text>
        <type value="dna"/>
        <coordinateSystem value="0"/>
        <referenceSeq>
          <referenceSeqId>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
              <code value="HLA00413"/>
            </coding>
            <text value="HLA-C*03:04:01:01"/>
          </referenceSeqId>
          <windowStart value="1001"/>
          <windowEnd value="1277"/>
        </referenceSeq>
        <observedSeq
                     value="GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"/>
      </MolecularSequence>
    </resource>
    <request>
      <method value="POST"/>
      <url value="MolecularSequence"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:709c5315-9403-4867-9d82-0b953836665f"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-24"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-24"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-24</b></p><a name="CG-IG-HLA-FullBundle-01-24"> </a><a name="hcCG-IG-HLA-FullBundle-01-24"> </a><a name="CG-IG-HLA-FullBundle-01-24-en-US"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84414-2}">Haplotype name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-C*01:02:01G}">HLA-C*01:02:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0">HLA-C*01:02:01, exon 2</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-46938bb2-0486-4e87-bfd3-89aab2d5e22f">HLA-C*01:02:01, exon 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4933}">HLA-C</span></td></tr></table></div>
        </text>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84414-2"/>
            <display value="Haplotype name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
            <version value="3.23"/>
            <code value="HLA-C*01:02:01G"/>
            <display value="HLA-C*01:02:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0"/>
          <type value="MolecularSequence"/>
          <display value="HLA-C*01:02:01, exon 2"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f"/>
          <type value="MolecularSequence"/>
          <display value="HLA-C*01:02:01, exon 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4933"/>
              <display value="HLA-C"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-25"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-25"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-25</b></p><a name="CG-IG-HLA-FullBundle-01-25"> </a><a name="hcCG-IG-HLA-FullBundle-01-25"> </a><a name="CG-IG-HLA-FullBundle-01-25-en-US"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84414-2}">Haplotype name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-C*01:02:01G}">HLA-C*01:02:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-2ae2ff34-279e-43c2-9018-b054fd3fc1ce">HLA-C*03:04:01:01, exon 2</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-19153ef1-68c6-47a2-9676-c4eefbd39af9">HLA-C*03:04:01:01, exon 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4933}">HLA-C</span></td></tr></table></div>
        </text>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84414-2"/>
            <display value="Haplotype name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
            <version value="3.23"/>
            <code value="HLA-C*01:02:01G"/>
            <display value="HLA-C*01:02:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce"/>
          <type value="MolecularSequence"/>
          <display value="HLA-C*03:04:01:01, exon 2"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9"/>
          <type value="MolecularSequence"/>
          <display value="HLA-C*03:04:01:01, exon 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4933"/>
              <display value="HLA-C"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208"/>
    <resource>
      <Observation>
        <id value="CG-IG-HLA-FullBundle-01-26"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="Observation_CG-IG-HLA-FullBundle-01-26"> </a><p class="res-header-id"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-26</b></p><a name="CG-IG-HLA-FullBundle-01-26"> </a><a name="hcCG-IG-HLA-FullBundle-01-26"> </a><a name="CG-IG-HLA-FullBundle-01-26-en-US"> </a><p><b>basedOn</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title="Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}">Laboratory</span>, <span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span></p><p><b>code</b>: <span title="Codes:{http://loinc.org 84413-4}">Genotype display name</span></p><p><b>subject</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab, Inc</a></p><p><b>value</b>: <span title="Codes:{http://glstring.org hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G}">hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G</span></p><p><b>method</b>: <span title="Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-8b2aa21c-1426-4717-8ab0-a84d83df7d47">HLA-C*03:04:01G, exons 2 and 3</a></li><li><a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-709c5315-9403-4867-9d82-0b953836665f">HLA-C*01:02:01G, exons 2 and 3</a></li></ul><h3>Components</h3><table class="grid"><tr><td style="display: none">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style="display: none">*</td><td><span title="Codes:{http://loinc.org 48018-6}">Gene studied [ID]</span></td><td><span title="Codes:{http://www.genenames.org HGNC:4933}">HLA-C</span></td></tr></table></div>
        </text>
        <basedOn>
          <reference value="urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea"/>
          <type value="ServiceRequest"/>
          <display value="Class I HLA genotyping for John Storm"/>
        </basedOn>
        <status value="final"/>
        <category>
          <coding>
            <system
                    value="http://terminology.hl7.org/CodeSystem/observation-category"/>
            <code value="laboratory"/>
          </coding>
        </category>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="84413-4"/>
            <display value="Genotype display name"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <display value="aTypingLab, Inc"/>
        </performer>
        <valueCodeableConcept>
          <coding>
            <system value="http://glstring.org"/>
            <version value="1.0"/>
            <code value="hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G"/>
          </coding>
        </valueCodeableConcept>
        <method>
          <coding>
            <system value="http://www.ncbi.nlm.nih.gov/gtr"/>
            <code value="GTR000000000.0"/>
          </coding>
          <text value="NGS based Class I HLA-A, -B, -C genotyping"/>
        </method>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <derivedFrom>
          <reference value="urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47"/>
          <type value="Observation"/>
          <display value="HLA-C*03:04:01G, exons 2 and 3"/>
        </derivedFrom>
        <derivedFrom>
          <reference value="urn:uuid:709c5315-9403-4867-9d82-0b953836665f"/>
          <type value="Observation"/>
          <display value="HLA-C*01:02:01G, exons 2 and 3"/>
        </derivedFrom>
        <component>
          <code>
            <coding>
              <system value="http://loinc.org"/>
              <code value="48018-6"/>
              <display value="Gene studied [ID]"/>
            </coding>
          </code>
          <valueCodeableConcept>
            <coding>
              <system value="http://www.genenames.org"/>
              <code value="HGNC:4933"/>
              <display value="HLA-C"/>
            </coding>
          </valueCodeableConcept>
        </component>
      </Observation>
    </resource>
    <request>
      <method value="POST"/>
      <url value="Observation"/>
    </request>
  </entry>
  <entry>
    <fullUrl value="urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9"/>
    <resource>
      <DiagnosticReport>
        <id value="CG-IG-HLA-FullBundle-01-27"/>
        <meta>
          <profile
                   value="http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report"/>
        </meta>
        <text>
          <status value="generated"/>
          <div xmlns="http://www.w3.org/1999/xhtml"><a name="DiagnosticReport_CG-IG-HLA-FullBundle-01-27"> </a><p class="res-header-id"><b>Generated Narrative: DiagnosticReport CG-IG-HLA-FullBundle-01-27</b></p><a name="CG-IG-HLA-FullBundle-01-27"> </a><a name="hcCG-IG-HLA-FullBundle-01-27"> </a><a name="CG-IG-HLA-FullBundle-01-27-en-US"> </a><h2><span title="Codes:{http://loinc.org 51969-4}, {http://www.genenames.org HGNC:588}">Genetic analysis report</span> (<span title="Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}">Genetics</span>) </h2><table class="grid"><tr><td>Subject</td><td>Not done yet</td></tr><tr><td>When For</td><td>2016-12-15</td></tr><tr><td>Reported</td><td>2016-12-15 14:15:30-0600</td></tr><tr><td>Performer</td><td> <a href="Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950">aTypingLab Inc</a></td></tr></table><p><b>Report Details</b></p><table class="grid"><tr><td><b>Code</b></td><td><b>Value</b></td></tr><tr><td/><td/></tr><tr><td/><td/></tr><tr><td/><td/></tr></table></div>
        </text>
        <extension
                   url="http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/>
              <version value="3.23"/>
            </coding>
          </valueCodeableConcept>
        </extension>
        <extension
                   url="http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring">
          <extension url="text">
            <valueString
                         value="HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G"/>
          </extension>
          <extension url="url">
            <valueUri
                      value="https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex"/>
          </extension>
        </extension>
        <basedOn>
          <reference value="urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea"/>
          <type value="ServiceRequest"/>
          <display value="Class I HLA genotyping for John Storm"/>
        </basedOn>
        <status value="final"/>
        <category>
          <coding>
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/>
            <code value="GE"/>
            <display value="Genetics"/>
          </coding>
        </category>
        <code>
          <coding>
            <system value="http://loinc.org"/>
            <code value="51969-4"/>
            <display value="Genetic analysis report"/>
          </coding>
          <coding>
            <system value="http://www.genenames.org"/>
            <code value="HGNC:588"/>
            <display value="Histocompatibility complex (HLA)"/>
          </coding>
        </code>
        <subject>
          <reference value="urn:uuid:13f34265-335c-4853-bc38-0815315edafa"/>
          <type value="Patient"/>
          <display value="John Storm"/>
        </subject>
        <effectiveDateTime value="2016-12-15"/>
        <issued value="2016-12-15T14:15:30-06:00"/>
        <performer>
          <reference value="urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"/>
          <type value="Organization"/>
          <display value="aTypingLab Inc"/>
        </performer>
        <specimen>
          <reference value="urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"/>
          <display value="buccal swab from John Storm"/>
        </specimen>
        <result>
          <reference value="urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228"/>
          <type value="Observation"/>
          <display value="HLA-A: HLA-A:01:01:01G+HLA-A*01:02"/>
        </result>
        <result>
          <reference value="urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70"/>
          <type value="Observation"/>
          <display value="HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G"/>
        </result>
        <result>
          <reference value="urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208"/>
          <type value="Observation"/>
          <display value="HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G"/>
        </result>
      </DiagnosticReport>
    </resource>
    <request>
      <method value="POST"/>
      <url value="DiagnosticReport"/>
    </request>
  </entry>
</Bundle>