Genomics Reporting Implementation Guide
3.0.1-SNAPSHOT - Ballot International flag

Genomics Reporting Implementation Guide, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 3.0.1-SNAPSHOT built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/genomics-reporting/ and changes regularly. See the Directory of published versions

: bundle-CG-IG-HLA-FullBundle-01 - TTL Representation

Raw ttl | Download

@prefix fhir: <http://hl7.org/fhir/> .
@prefix loinc: <https://loinc.org/rdf/> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix sct: <http://snomed.info/id/> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .

# - resource -------------------------------------------------------------------

 a fhir:Bundle ;
  fhir:nodeRole fhir:treeRoot ;
  fhir:id [ fhir:v "bundle-CG-IG-HLA-FullBundle-01"] ; # 
  fhir:type [ fhir:v "transaction"] ; # 
  fhir:entry ( [
fhir:fullUrl [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:13f34265-335c-4853-bc38-0815315edafa> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Patient"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Specimen"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Organization"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Organization"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "ServiceRequest"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "MolecularSequence"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:709c5315-9403-4867-9d82-0b953836665f"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:709c5315-9403-4867-9d82-0b953836665f> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "Observation"^^xsd:anyURI ]     ]
  ] [
fhir:fullUrl [ fhir:v "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9"^^xsd:anyURI ] ;
    ( fhir:resource <urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> ) ;
fhir:request [
fhir:method [ fhir:v "POST" ] ;
fhir:url [ fhir:v "DiagnosticReport"^^xsd:anyURI ]     ]
  ] ) . # 

<urn:uuid:13f34265-335c-4853-bc38-0815315edafa> a fhir:Patient ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-1"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Patient_CG-IG-HLA-FullBundle-01-1\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Patient CG-IG-HLA-FullBundle-01-1</b></p><a name=\"CG-IG-HLA-FullBundle-01-1\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-1\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-1-en-US\"> </a><p style=\"border: 1px #661aff solid; background-color: #e6e6ff; padding: 10px;\">John Storm(official) Male, DoB: 1986-12-31 ( Donor Registration Number (use: usual, period: 2012-11-10 --&gt; (ongoing)))</p><hr/></div>"
  ] ; # 
  fhir:identifier ( [
fhir:use [ fhir:v "usual" ] ;
fhir:type [
      ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0203"^^xsd:anyURI ] ;
fhir:code [ fhir:v "DR" ]       ] )     ] ;
fhir:system [ fhir:v "urn:oid:0.0.0.0.0.0.0"^^xsd:anyURI ] ;
fhir:value [ fhir:v "12345" ] ;
fhir:period [
fhir:start [ fhir:v "2012-11-10"^^xsd:date ]     ] ;
fhir:assigner [
fhir:display [ fhir:v "aDonorRegistry" ]     ]
  ] ) ; # 
  fhir:name ( [
fhir:use [ fhir:v "official" ] ;
fhir:text [ fhir:v "John Storm" ] ;
fhir:family [ fhir:v "Storm" ] ;
    ( fhir:given [ fhir:v "John" ] )
  ] [
fhir:use [ fhir:v "nickname" ] ;
fhir:text [ fhir:v "Johnny Storm" ] ;
fhir:family [ fhir:v "Storm" ] ;
    ( fhir:given [ fhir:v "Johnny" ] )
  ] [
fhir:use [ fhir:v "nickname" ] ;
fhir:text [ fhir:v "The Human Torch" ]
  ] ) ; # 
  fhir:gender [ fhir:v "male"] ; # 
  fhir:birthDate [ fhir:v "1986-12-31"^^xsd:date] . # 

<urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340> a fhir:Specimen ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-2"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Specimen_CG-IG-HLA-FullBundle-01-2\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Specimen CG-IG-HLA-FullBundle-01-2</b></p><a name=\"CG-IG-HLA-FullBundle-01-2\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-2\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-2-en-US\"> </a><p><b>identifier</b>: <code>http://myorgsurl.com</code>/123</p><p><b>accessionIdentifier</b>: <code>http://mylabsurl.com</code>/456</p><p><b>type</b>: <span title=\"Codes:{http://snomed.info/sct 122555007}\">Venous blood specimen</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p></div>"
  ] ; # 
  fhir:identifier ( [
fhir:system [ fhir:v "http://myorgsurl.com"^^xsd:anyURI ] ;
fhir:value [ fhir:v "123" ]
  ] ) ; # 
  fhir:accessionIdentifier [
fhir:system [ fhir:v "http://mylabsurl.com"^^xsd:anyURI ] ;
fhir:value [ fhir:v "456" ]
  ] ; # 
  fhir:type [
    ( fhir:coding [
a sct:122555007 ;
fhir:system [ fhir:v "http://snomed.info/sct"^^xsd:anyURI ] ;
fhir:code [ fhir:v "122555007" ] ;
fhir:display [ fhir:v "Venous blood specimen" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] . # 

<urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950> a fhir:Organization ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-3"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Organization_CG-IG-HLA-FullBundle-01-3\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Organization CG-IG-HLA-FullBundle-01-3</b></p><a name=\"CG-IG-HLA-FullBundle-01-3\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-3\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-3-en-US\"> </a><p><b>name</b>: aTypingLab Inc</p><p><b>alias</b>: aTL</p><p><b>telecom</b>: ph: 1-800-555-1234(Work)</p><p><b>address</b>: 123 Main St, Sometown, ND 99999(work)</p></div>"
  ] ; # 
  fhir:name [ fhir:v "aTypingLab Inc"] ; # 
  fhir:alias ( [ fhir:v "aTL"] ) ; # 
  fhir:telecom ( [
fhir:system [ fhir:v "phone" ] ;
fhir:value [ fhir:v "1-800-555-1234" ] ;
fhir:use [ fhir:v "work" ] ;
fhir:rank [ fhir:v "1"^^xsd:positiveInteger ]
  ] ) ; # 
  fhir:address ( [
fhir:use [ fhir:v "work" ] ;
fhir:type [ fhir:v "both" ] ;
fhir:text [ fhir:v "123 Main St, Sometown, ND 99999" ] ;
    ( fhir:line [ fhir:v "123 Main St" ] ) ;
fhir:city [ fhir:v "Sometown" ] ;
fhir:state [ fhir:v "ND" ] ;
fhir:postalCode [ fhir:v "99999" ] ;
fhir:country [ fhir:v "USA" ]
  ] ) . # 

<urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5> a fhir:Organization ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-4"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Organization_CG-IG-HLA-FullBundle-01-4\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Organization CG-IG-HLA-FullBundle-01-4</b></p><a name=\"CG-IG-HLA-FullBundle-01-4\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-4\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-4-en-US\"> </a><p><b>name</b>: aDonorRegistry</p><p><b>alias</b>: ADR</p><p><b>telecom</b>: ph: 1-800-555-6789(Work)</p><p><b>address</b>: 456 Main St, Anytown ND, 00000(work)</p></div>"
  ] ; # 
  fhir:name [ fhir:v "aDonorRegistry"] ; # 
  fhir:alias ( [ fhir:v "ADR"] ) ; # 
  fhir:telecom ( [
fhir:system [ fhir:v "phone" ] ;
fhir:value [ fhir:v "1-800-555-6789" ] ;
fhir:use [ fhir:v "work" ] ;
fhir:rank [ fhir:v "1"^^xsd:positiveInteger ]
  ] ) ; # 
  fhir:address ( [
fhir:use [ fhir:v "work" ] ;
fhir:type [ fhir:v "both" ] ;
fhir:text [ fhir:v "456 Main St, Anytown ND, 00000" ] ;
    ( fhir:line [ fhir:v "456 Main St" ] ) ;
fhir:city [ fhir:v "Anytown" ] ;
fhir:state [ fhir:v "ND" ] ;
fhir:postalCode [ fhir:v "00000" ] ;
fhir:country [ fhir:v "USA" ]
  ] ) . # 

<urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea> a fhir:ServiceRequest ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-5"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"ServiceRequest_CG-IG-HLA-FullBundle-01-5\"> </a><p class=\"res-header-id\"><b>Generated Narrative: ServiceRequest CG-IG-HLA-FullBundle-01-5</b></p><a name=\"CG-IG-HLA-FullBundle-01-5\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-5\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-5-en-US\"> </a><p><b>status</b>: Completed</p><p><b>intent</b>: Order</p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 13303-3}\">HLA-A+B+C (class I) [Type]</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>authoredOn</b>: 2016-11-15</p><p><b>requester</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-00ef18ad-ed04-4b2c-81ee-b69bb243f0d5\">aDonorRegistry</a></p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>reasonCode</b>: <span title=\"Codes:\">tissue typing for donor registry</span></p></div>"
  ] ; # 
  fhir:status [ fhir:v "completed"] ; # 
  fhir:intent [ fhir:v "order"] ; # 
  fhir:code [
    ( fhir:coding [
a loinc:13303-3 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "13303-3" ] ;
fhir:display [ fhir:v "HLA-A+B+C (class I) [Type]" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:authoredOn [ fhir:v "2016-11-15"^^xsd:date] ; # 
  fhir:requester [
fhir:reference [ fhir:v "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5" ] ;
fhir:type [ fhir:v "Organization"^^xsd:anyURI ] ;
fhir:display [ fhir:v "aDonorRegistry" ]
  ] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:type [ fhir:v "Organization"^^xsd:anyURI ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:reasonCode ( [
fhir:text [ fhir:v "tissue typing for donor registry" ]
  ] ) . # 

<urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-6"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-6\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-6</b></p><a name=\"CG-IG-HLA-FullBundle-01-6\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-6\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-6-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00001}\">HLA-A*01:01:01:01</span></td><td>503</td><td>773</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00001" ]       ] ) ;
fhir:text [ fhir:v "HLA-A*01:01:01:01" ]     ] ;
fhir:windowStart [ fhir:v "503"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "773"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"] . # 

<urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-7"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-7\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-7</b></p><a name=\"CG-IG-HLA-FullBundle-01-7\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-7\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-7-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00001}\">HLA-A*01:01:01:01</span></td><td>1014</td><td>1290</td></tr></table><p><b>observedSeq</b>: GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00001" ]       ] ) ;
fhir:text [ fhir:v "HLA-A*01:01:01:01" ]     ] ;
fhir:windowStart [ fhir:v "1014"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "1290"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"] . # 

<urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-8"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-8\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-8</b></p><a name=\"CG-IG-HLA-FullBundle-01-8\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-8\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-8-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00002}\">HLA-A*01:02</span></td><td>503</td><td>773</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00002" ]       ] ) ;
fhir:text [ fhir:v "HLA-A*01:02" ]     ] ;
fhir:windowStart [ fhir:v "503"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "773"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"] . # 

<urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-9"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-9\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-9</b></p><a name=\"CG-IG-HLA-FullBundle-01-9\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-9\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-9-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00002}\">HLA-A*01:02</span></td><td>1014</td><td>1290</td></tr></table><p><b>observedSeq</b>: GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00002" ]       ] ) ;
fhir:text [ fhir:v "HLA-A*01:02" ]     ] ;
fhir:windowStart [ fhir:v "1014"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "1290"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"] . # 

<urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-10"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-10\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-10</b></p><a name=\"CG-IG-HLA-FullBundle-01-10\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-10\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-10-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-A*01:01:01G}\">HLA-A*01:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-8200dab6-18a2-4550-b913-a7db480c0804\">HLA-A*01:01:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-7c393185-f15c-45bc-a714-c0fdbea32675\">HLA-A*01:01:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4931}\">HLA-A</span></td></tr></table></div>"
  ] ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84414-2 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84414-2" ] ;
fhir:display [ fhir:v "Haplotype name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA-A*01:01:01G" ] ;
fhir:display [ fhir:v "HLA-A*01:01:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A*01:01:01:01, exon 2" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A*01:01:01:01, exon 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4931" ] ;
fhir:display [ fhir:v "HLA-A" ]       ] )     ]
  ] ) . # 

<urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-11"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-11\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-11</b></p><a name=\"CG-IG-HLA-FullBundle-01-11\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-11\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-11-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-A*01:02}\">HLA-A*01:02</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-65c85f14-c3a0-4b72-818f-820e04fcc621\">HLA-A*01:02, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-fbba9fe7-0ece-4ec1-9233-a437a8d242a0\">HLA-A*01:02, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4931}\">HLA-A</span></td></tr></table></div>"
  ] ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84414-2 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84414-2" ] ;
fhir:display [ fhir:v "Haplotype name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA-A*01:02" ] ;
fhir:display [ fhir:v "HLA-A*01:02" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A*01:02, exon 2" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A*01:02, exon 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4931" ] ;
fhir:display [ fhir:v "HLA-A" ]       ] )     ]
  ] ) . # 

<urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-12"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-12\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-12</b></p><a name=\"CG-IG-HLA-FullBundle-01-12\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-12\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-12-en-US\"> </a><p><b>basedOn</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea\">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84413-4}\">Genotype display name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://glstring.org hla#3.23.0#HLA-A:01:01G+HLA-A*01:02}\">hla#3.23.0#HLA-A:01:01G+HLA-A*01:02</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-b7765bbf-df40-486a-9f2f-404309643de6\">HLA-A*01:01:01G, exons 2 and 3</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-d98d92a7-0e86-4ae5-b036-b7e1bba6ec32\">HLA-A*01:02, exons 2 and 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4931}\">HLA-A</span></td></tr></table></div>"
  ] ; # 
  fhir:basedOn ( [
fhir:reference [ fhir:v "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ] ;
fhir:type [ fhir:v "ServiceRequest"^^xsd:anyURI ] ;
fhir:display [ fhir:v "Class I HLA genotyping for John Storm" ]
  ] ) ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84413-4 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84413-4" ] ;
fhir:display [ fhir:v "Genotype display name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://glstring.org"^^xsd:anyURI ] ;
fhir:version [ fhir:v "1.0" ] ;
fhir:code [ fhir:v "hla#3.23.0#HLA-A:01:01G+HLA-A*01:02" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A*01:01:01G, exons 2 and 3" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A*01:02, exons 2 and 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4931" ] ;
fhir:display [ fhir:v "HLA-A" ]       ] )     ]
  ] ) . # 

<urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-13"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-13\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-13</b></p><a name=\"CG-IG-HLA-FullBundle-01-13\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-13\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-13-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00162}\">HLA-B*15:01:01:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00162" ]       ] ) ;
fhir:text [ fhir:v "HLA-B*15:01:01:01" ]     ] ;
fhir:windowStart [ fhir:v "486"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "756"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] . # 

<urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-14"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-14\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-14</b></p><a name=\"CG-IG-HLA-FullBundle-01-14\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-14\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-14-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00162}\">HLA-B*15:01:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00162" ]       ] ) ;
fhir:text [ fhir:v "HLA-B*15:01:01:01" ]     ] ;
fhir:windowStart [ fhir:v "1001"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "1277"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] . # 

<urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-15"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-15\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-15</b></p><a name=\"CG-IG-HLA-FullBundle-01-15\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-15\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-15-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00381}\">HLA-B*57:01:01</span></td><td>485</td><td>755</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00381" ]       ] ) ;
fhir:text [ fhir:v "HLA-B*57:01:01" ]     ] ;
fhir:windowStart [ fhir:v "485"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "755"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"] . # 

<urn:uuid:db69e549-6267-4777-b4b9-8813f3329309> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-16"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-16\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-16</b></p><a name=\"CG-IG-HLA-FullBundle-01-16\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-16\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-16-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00381}\">HLA-B*57:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00381" ]       ] ) ;
fhir:text [ fhir:v "HLA-B*57:01:01" ]     ] ;
fhir:windowStart [ fhir:v "1001"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "1277"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] . # 

<urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-17"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-17\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-17</b></p><a name=\"CG-IG-HLA-FullBundle-01-17\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-17\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-17-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HGG00041}\">HLA-B*15:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-cbabf93e-1b4b-46f2-ba1e-d84862670670\">HLA-B*15:01:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-c233ad3d-1572-48d6-93da-0a583535e138\">HLA-B*15:01:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4932}\">HLA-B</span></td></tr></table></div>"
  ] ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84414-2 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84414-2" ] ;
fhir:display [ fhir:v "Haplotype name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HGG00041" ] ;
fhir:display [ fhir:v "HLA-B*15:01:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B*15:01:01:01, exon 2" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B*15:01:01:01, exon 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4932" ] ;
fhir:display [ fhir:v "HLA-B" ]       ] )     ]
  ] ) . # 

<urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-18"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-18\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-18</b></p><a name=\"CG-IG-HLA-FullBundle-01-18\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-18\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-18-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-B*57:01:01G}\">HLA-B*57:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-05fa52d7-5c67-460a-8722-d3460b24d6fe\">HLA-B*57:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-db69e549-6267-4777-b4b9-8813f3329309\">HLA-B*57:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4932}\">HLA-B</span></td></tr></table></div>"
  ] ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84414-2 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84414-2" ] ;
fhir:display [ fhir:v "Haplotype name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA-B*57:01:01G" ] ;
fhir:display [ fhir:v "HLA-B*57:01:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B*57:01:01, exon 2" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B*57:01:01, exon 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4932" ] ;
fhir:display [ fhir:v "HLA-B" ]       ] )     ]
  ] ) . # 

<urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-19"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-19\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-19</b></p><a name=\"CG-IG-HLA-FullBundle-01-19\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-19\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-19-en-US\"> </a><p><b>basedOn</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea\">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84413-4}\">Genotype display name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://glstring.org hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G}\">hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e2092243-2970-49d2-a90f-b90d1d49715a\">HLA-B*15:01:01G, exons 2 and 3</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-792be53e-d4fb-4887-a367-815ef6c706e5\">HLA-B*57:01:01G, exons 2 and 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4932}\">HLA-B</span></td></tr></table></div>"
  ] ; # 
  fhir:basedOn ( [
fhir:reference [ fhir:v "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ] ;
fhir:type [ fhir:v "ServiceRequest"^^xsd:anyURI ] ;
fhir:display [ fhir:v "Class I HLA genotyping for John Storm" ]
  ] ) ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84413-4 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84413-4" ] ;
fhir:display [ fhir:v "Genotype display name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://glstring.org"^^xsd:anyURI ] ;
fhir:version [ fhir:v "1.0" ] ;
fhir:code [ fhir:v "hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B*15:01:01G, exons 2 and 3" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B*57:01:01G, exons 2 and 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4932" ] ;
fhir:display [ fhir:v "HLA-B" ]       ] )     ]
  ] ) . # 

<urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-20"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-20\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-20</b></p><a name=\"CG-IG-HLA-FullBundle-01-20\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-20\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-20-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00401}\">HLA-C*01:02:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00401" ]       ] ) ;
fhir:text [ fhir:v "HLA-C*01:02:01" ]     ] ;
fhir:windowStart [ fhir:v "486"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "756"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] . # 

<urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-21"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-21\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-21</b></p><a name=\"CG-IG-HLA-FullBundle-01-21\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-21\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-21-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00401}\">HLA-C*01:02:01</span></td><td>1002</td><td>1278</td></tr></table><p><b>observedSeq</b>: GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00401" ]       ] ) ;
fhir:text [ fhir:v "HLA-C*01:02:01" ]     ] ;
fhir:windowStart [ fhir:v "1002"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "1278"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"] . # 

<urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-22"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-22\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-22</b></p><a name=\"CG-IG-HLA-FullBundle-01-22\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-22\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-22-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00413}\">HLA-C*03:04:01:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00413" ]       ] ) ;
fhir:text [ fhir:v "HLA-C*03:04:01:01" ]     ] ;
fhir:windowStart [ fhir:v "486"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "756"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"] . # 

<urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9> a fhir:MolecularSequence ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-23"] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-23\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-23</b></p><a name=\"CG-IG-HLA-FullBundle-01-23\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-23\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-23-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00413}\">HLA-C*03:04:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
  ] ; # 
  fhir:type [ fhir:v "dna"] ; # 
  fhir:coordinateSystem [ fhir:v "0"^^xsd:integer] ; # 
  fhir:referenceSeq [
fhir:referenceSeqId [
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA00413" ]       ] ) ;
fhir:text [ fhir:v "HLA-C*03:04:01:01" ]     ] ;
fhir:windowStart [ fhir:v "1001"^^xsd:integer ] ;
fhir:windowEnd [ fhir:v "1277"^^xsd:integer ]
  ] ; # 
  fhir:observedSeq [ fhir:v "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"] . # 

<urn:uuid:709c5315-9403-4867-9d82-0b953836665f> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-24"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-24\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-24</b></p><a name=\"CG-IG-HLA-FullBundle-01-24\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-24\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-24-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-C*01:02:01G}\">HLA-C*01:02:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0\">HLA-C*01:02:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-46938bb2-0486-4e87-bfd3-89aab2d5e22f\">HLA-C*01:02:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4933}\">HLA-C</span></td></tr></table></div>"
  ] ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84414-2 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84414-2" ] ;
fhir:display [ fhir:v "Haplotype name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA-C*01:02:01G" ] ;
fhir:display [ fhir:v "HLA-C*01:02:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C*01:02:01, exon 2" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C*01:02:01, exon 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4933" ] ;
fhir:display [ fhir:v "HLA-C" ]       ] )     ]
  ] ) . # 

<urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-25"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-25\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-25</b></p><a name=\"CG-IG-HLA-FullBundle-01-25\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-25\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-25-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-C*01:02:01G}\">HLA-C*01:02:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-2ae2ff34-279e-43c2-9018-b054fd3fc1ce\">HLA-C*03:04:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-19153ef1-68c6-47a2-9676-c4eefbd39af9\">HLA-C*03:04:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4933}\">HLA-C</span></td></tr></table></div>"
  ] ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84414-2 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84414-2" ] ;
fhir:display [ fhir:v "Haplotype name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ] ;
fhir:code [ fhir:v "HLA-C*01:02:01G" ] ;
fhir:display [ fhir:v "HLA-C*01:02:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C*03:04:01:01, exon 2" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9" ] ;
fhir:type [ fhir:v "MolecularSequence"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C*03:04:01:01, exon 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4933" ] ;
fhir:display [ fhir:v "HLA-C" ]       ] )     ]
  ] ) . # 

<urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208> a fhir:Observation ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-26"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-26\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-26</b></p><a name=\"CG-IG-HLA-FullBundle-01-26\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-26\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-26-en-US\"> </a><p><b>basedOn</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea\">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84413-4}\">Genotype display name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://glstring.org hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G}\">hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-8b2aa21c-1426-4717-8ab0-a84d83df7d47\">HLA-C*03:04:01G, exons 2 and 3</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-709c5315-9403-4867-9d82-0b953836665f\">HLA-C*01:02:01G, exons 2 and 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4933}\">HLA-C</span></td></tr></table></div>"
  ] ; # 
  fhir:basedOn ( [
fhir:reference [ fhir:v "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ] ;
fhir:type [ fhir:v "ServiceRequest"^^xsd:anyURI ] ;
fhir:display [ fhir:v "Class I HLA genotyping for John Storm" ]
  ] ) ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/observation-category"^^xsd:anyURI ] ;
fhir:code [ fhir:v "laboratory" ]     ] )
  ] [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:84413-4 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "84413-4" ] ;
fhir:display [ fhir:v "Genotype display name" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:display [ fhir:v "aTypingLab, Inc" ]
  ] ) ; # 
  fhir:value [
a fhir:CodeableConcept ;
    ( fhir:coding [
fhir:system [ fhir:v "http://glstring.org"^^xsd:anyURI ] ;
fhir:version [ fhir:v "1.0" ] ;
fhir:code [ fhir:v "hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G" ]     ] )
  ] ; # 
  fhir:method [
    ( fhir:coding [
fhir:system [ fhir:v "http://www.ncbi.nlm.nih.gov/gtr"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GTR000000000.0" ]     ] ) ;
fhir:text [ fhir:v "NGS based Class I HLA-A, -B, -C genotyping" ]
  ] ; # 
  fhir:specimen [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ; # 
  fhir:derivedFrom ( [
fhir:reference [ fhir:v "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C*03:04:01G, exons 2 and 3" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:709c5315-9403-4867-9d82-0b953836665f" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C*01:02:01G, exons 2 and 3" ]
  ] ) ; # 
  fhir:component ( [
fhir:code [
      ( fhir:coding [
a loinc:48018-6 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "48018-6" ] ;
fhir:display [ fhir:v "Gene studied [ID]" ]       ] )     ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:4933" ] ;
fhir:display [ fhir:v "HLA-C" ]       ] )     ]
  ] ) . # 

<urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9> a fhir:DiagnosticReport ;
  fhir:id [ fhir:v "CG-IG-HLA-FullBundle-01-27"] ; # 
  fhir:meta [
    ( fhir:profile [
fhir:v "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report"^^xsd:anyURI ;
fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report>     ] )
  ] ; # 
  fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"DiagnosticReport_CG-IG-HLA-FullBundle-01-27\"> </a><p class=\"res-header-id\"><b>Generated Narrative: DiagnosticReport CG-IG-HLA-FullBundle-01-27</b></p><a name=\"CG-IG-HLA-FullBundle-01-27\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-27\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-27-en-US\"> </a><h2><span title=\"Codes:{http://loinc.org 51969-4}, {http://www.genenames.org HGNC:588}\">Genetic analysis report</span> (<span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span>) </h2><table class=\"grid\"><tr><td>Subject</td><td>Not done yet</td></tr><tr><td>When For</td><td>2016-12-15</td></tr><tr><td>Reported</td><td>2016-12-15 14:15:30-0600</td></tr><tr><td>Performer</td><td> <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab Inc</a></td></tr></table><p><b>Report Details</b></p><table class=\"grid\"><tr><td><b>Code</b></td><td><b>Value</b></td></tr><tr><td/><td/></tr><tr><td/><td/></tr><tr><td/><td/></tr></table></div>"
  ] ; # 
  fhir:extension ( [
fhir:url [ fhir:v "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database"^^xsd:anyURI ] ;
fhir:value [
a fhir:CodeableConcept ;
      ( fhir:coding [
fhir:system [ fhir:v "http://www.ebi.ac.uk/ipd/imgt/hla"^^xsd:anyURI ] ;
fhir:version [ fhir:v "3.23" ]       ] )     ]
  ] [
    ( fhir:extension [
fhir:url [ fhir:v "text"^^xsd:anyURI ] ;
fhir:value [ fhir:v "HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G" ]     ] [
fhir:url [ fhir:v "url"^^xsd:anyURI ] ;
fhir:value [ fhir:v "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex"^^xsd:anyURI ]     ] ) ;
fhir:url [ fhir:v "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring"^^xsd:anyURI ]
  ] ) ; # 
  fhir:basedOn ( [
fhir:reference [ fhir:v "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea" ] ;
fhir:type [ fhir:v "ServiceRequest"^^xsd:anyURI ] ;
fhir:display [ fhir:v "Class I HLA genotyping for John Storm" ]
  ] ) ; # 
  fhir:status [ fhir:v "final"] ; # 
  fhir:category ( [
    ( fhir:coding [
fhir:system [ fhir:v "http://terminology.hl7.org/CodeSystem/v2-0074"^^xsd:anyURI ] ;
fhir:code [ fhir:v "GE" ] ;
fhir:display [ fhir:v "Genetics" ]     ] )
  ] ) ; # 
  fhir:code [
    ( fhir:coding [
a loinc:51969-4 ;
fhir:system [ fhir:v "http://loinc.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "51969-4" ] ;
fhir:display [ fhir:v "Genetic analysis report" ]     ] [
fhir:system [ fhir:v "http://www.genenames.org"^^xsd:anyURI ] ;
fhir:code [ fhir:v "HGNC:588" ] ;
fhir:display [ fhir:v "Histocompatibility complex (HLA)" ]     ] )
  ] ; # 
  fhir:subject [
fhir:reference [ fhir:v "urn:uuid:13f34265-335c-4853-bc38-0815315edafa" ] ;
fhir:type [ fhir:v "Patient"^^xsd:anyURI ] ;
fhir:display [ fhir:v "John Storm" ]
  ] ; # 
  fhir:effective [ fhir:v "2016-12-15"^^xsd:date] ; # 
  fhir:issued [ fhir:v "2016-12-15T14:15:30-06:00"^^xsd:dateTime] ; # 
  fhir:performer ( [
fhir:reference [ fhir:v "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950" ] ;
fhir:type [ fhir:v "Organization"^^xsd:anyURI ] ;
fhir:display [ fhir:v "aTypingLab Inc" ]
  ] ) ; # 
  fhir:specimen ( [
fhir:reference [ fhir:v "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340" ] ;
fhir:display [ fhir:v "buccal swab from John Storm" ]
  ] ) ; # 
  fhir:result ( [
fhir:reference [ fhir:v "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-A: HLA-A:01:01:01G+HLA-A*01:02" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G" ]
  ] [
fhir:reference [ fhir:v "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208" ] ;
fhir:type [ fhir:v "Observation"^^xsd:anyURI ] ;
fhir:display [ fhir:v "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G" ]
  ] ) . #