Genomics Reporting Implementation Guide
3.0.1-SNAPSHOT - Ballot International flag

Genomics Reporting Implementation Guide, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 3.0.1-SNAPSHOT built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/genomics-reporting/ and changes regularly. See the Directory of published versions

: bundle-CG-IG-HLA-FullBundle-01 - JSON Representation

Raw json | Download


{
  "resourceType" : "Bundle",
  "id" : "bundle-CG-IG-HLA-FullBundle-01",
  "type" : "transaction",
  "entry" : [
    {
      "fullUrl" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
      "resource" : {
        "resourceType" : "Patient",
        "id" : "CG-IG-HLA-FullBundle-01-1",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Patient_CG-IG-HLA-FullBundle-01-1\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Patient CG-IG-HLA-FullBundle-01-1</b></p><a name=\"CG-IG-HLA-FullBundle-01-1\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-1\"> </a><a name=\"CG-IG-HLA-FullBundle-01-1-en-US\"> </a><p style=\"border: 1px #661aff solid; background-color: #e6e6ff; padding: 10px;\">John Storm(official) Male, DoB: 1986-12-31 ( Donor Registration Number\u00a0(use:\u00a0usual,\u00a0period:\u00a02012-11-10 --&gt; (ongoing)))</p><hr/></div>"
        },
        "identifier" : [
          {
            "use" : "usual",
            "type" : {
              "coding" : [
                {
                  "system" : "http://terminology.hl7.org/CodeSystem/v2-0203",
                  "code" : "DR"
                }
              ]
            },
            "system" : "urn:oid:0.0.0.0.0.0.0",
            "value" : "12345",
            "period" : {
              "start" : "2012-11-10"
            },
            "assigner" : {
              "display" : "aDonorRegistry"
            }
          }
        ],
        "name" : [
          {
            "use" : "official",
            "text" : "John Storm",
            "family" : "Storm",
            "given" : [
              "John"
            ]
          },
          {
            "use" : "nickname",
            "text" : "Johnny Storm",
            "family" : "Storm",
            "given" : [
              "Johnny"
            ]
          },
          {
            "use" : "nickname",
            "text" : "The Human Torch"
          }
        ],
        "gender" : "male",
        "birthDate" : "1986-12-31"
      },
      "request" : {
        "method" : "POST",
        "url" : "Patient"
      }
    },
    {
      "fullUrl" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
      "resource" : {
        "resourceType" : "Specimen",
        "id" : "CG-IG-HLA-FullBundle-01-2",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Specimen_CG-IG-HLA-FullBundle-01-2\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Specimen CG-IG-HLA-FullBundle-01-2</b></p><a name=\"CG-IG-HLA-FullBundle-01-2\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-2\"> </a><a name=\"CG-IG-HLA-FullBundle-01-2-en-US\"> </a><p><b>identifier</b>: <code>http://myorgsurl.com</code>/123</p><p><b>accessionIdentifier</b>: <code>http://mylabsurl.com</code>/456</p><p><b>type</b>: <span title=\"Codes:{http://snomed.info/sct 122555007}\">Venous blood specimen</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p></div>"
        },
        "identifier" : [
          {
            "system" : "http://myorgsurl.com",
            "value" : "123"
          }
        ],
        "accessionIdentifier" : {
          "system" : "http://mylabsurl.com",
          "value" : "456"
        },
        "type" : {
          "coding" : [
            {
              "system" : "http://snomed.info/sct",
              "code" : "122555007",
              "display" : "Venous blood specimen"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        }
      },
      "request" : {
        "method" : "POST",
        "url" : "Specimen"
      }
    },
    {
      "fullUrl" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
      "resource" : {
        "resourceType" : "Organization",
        "id" : "CG-IG-HLA-FullBundle-01-3",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Organization_CG-IG-HLA-FullBundle-01-3\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Organization CG-IG-HLA-FullBundle-01-3</b></p><a name=\"CG-IG-HLA-FullBundle-01-3\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-3\"> </a><a name=\"CG-IG-HLA-FullBundle-01-3-en-US\"> </a><p><b>name</b>: aTypingLab Inc</p><p><b>alias</b>: aTL</p><p><b>telecom</b>: ph: 1-800-555-1234(Work)</p><p><b>address</b>: 123 Main St, Sometown, ND 99999(work)</p></div>"
        },
        "name" : "aTypingLab Inc",
        "alias" : [
          "aTL"
        ],
        "telecom" : [
          {
            "system" : "phone",
            "value" : "1-800-555-1234",
            "use" : "work",
            "rank" : 1
          }
        ],
        "address" : [
          {
            "use" : "work",
            "type" : "both",
            "text" : "123 Main St, Sometown, ND 99999",
            "line" : [
              "123 Main St"
            ],
            "city" : "Sometown",
            "state" : "ND",
            "postalCode" : "99999",
            "country" : "USA"
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Organization"
      }
    },
    {
      "fullUrl" : "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5",
      "resource" : {
        "resourceType" : "Organization",
        "id" : "CG-IG-HLA-FullBundle-01-4",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Organization_CG-IG-HLA-FullBundle-01-4\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Organization CG-IG-HLA-FullBundle-01-4</b></p><a name=\"CG-IG-HLA-FullBundle-01-4\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-4\"> </a><a name=\"CG-IG-HLA-FullBundle-01-4-en-US\"> </a><p><b>name</b>: aDonorRegistry</p><p><b>alias</b>: ADR</p><p><b>telecom</b>: ph: 1-800-555-6789(Work)</p><p><b>address</b>: 456 Main St, Anytown ND, 00000(work)</p></div>"
        },
        "name" : "aDonorRegistry",
        "alias" : [
          "ADR"
        ],
        "telecom" : [
          {
            "system" : "phone",
            "value" : "1-800-555-6789",
            "use" : "work",
            "rank" : 1
          }
        ],
        "address" : [
          {
            "use" : "work",
            "type" : "both",
            "text" : "456 Main St, Anytown ND, 00000",
            "line" : [
              "456 Main St"
            ],
            "city" : "Anytown",
            "state" : "ND",
            "postalCode" : "00000",
            "country" : "USA"
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Organization"
      }
    },
    {
      "fullUrl" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
      "resource" : {
        "resourceType" : "ServiceRequest",
        "id" : "CG-IG-HLA-FullBundle-01-5",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"ServiceRequest_CG-IG-HLA-FullBundle-01-5\"> </a><p class=\"res-header-id\"><b>Generated Narrative: ServiceRequest CG-IG-HLA-FullBundle-01-5</b></p><a name=\"CG-IG-HLA-FullBundle-01-5\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-5\"> </a><a name=\"CG-IG-HLA-FullBundle-01-5-en-US\"> </a><p><b>status</b>: Completed</p><p><b>intent</b>: Order</p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 13303-3}\">HLA-A+B+C (class I) [Type]</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>authoredOn</b>: 2016-11-15</p><p><b>requester</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-00ef18ad-ed04-4b2c-81ee-b69bb243f0d5\">aDonorRegistry</a></p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>reasonCode</b>: <span title=\"Codes:\">tissue typing for donor registry</span></p></div>"
        },
        "status" : "completed",
        "intent" : "order",
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "13303-3",
              "display" : "HLA-A+B+C (class I) [Type]"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "authoredOn" : "2016-11-15",
        "requester" : {
          "reference" : "urn:uuid:00ef18ad-ed04-4b2c-81ee-b69bb243f0d5",
          "type" : "Organization",
          "display" : "aDonorRegistry"
        },
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "type" : "Organization",
            "display" : "aTypingLab, Inc"
          }
        ],
        "reasonCode" : [
          {
            "text" : "tissue typing for donor registry"
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "ServiceRequest"
      }
    },
    {
      "fullUrl" : "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-6",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-6\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-6</b></p><a name=\"CG-IG-HLA-FullBundle-01-6\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-6\"> </a><a name=\"CG-IG-HLA-FullBundle-01-6-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00001}\">HLA-A*01:01:01:01</span></td><td>503</td><td>773</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00001"
              }
            ],
            "text" : "HLA-A*01:01:01:01"
          },
          "windowStart" : 503,
          "windowEnd" : 773
        },
        "observedSeq" : "GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-7",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-7\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-7</b></p><a name=\"CG-IG-HLA-FullBundle-01-7\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-7\"> </a><a name=\"CG-IG-HLA-FullBundle-01-7-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00001}\">HLA-A*01:01:01:01</span></td><td>1014</td><td>1290</td></tr></table><p><b>observedSeq</b>: GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00001"
              }
            ],
            "text" : "HLA-A*01:01:01:01"
          },
          "windowStart" : 1014,
          "windowEnd" : 1290
        },
        "observedSeq" : "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-8",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-8\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-8</b></p><a name=\"CG-IG-HLA-FullBundle-01-8\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-8\"> </a><a name=\"CG-IG-HLA-FullBundle-01-8-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00002}\">HLA-A*01:02</span></td><td>503</td><td>773</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00002"
              }
            ],
            "text" : "HLA-A*01:02"
          },
          "windowStart" : 503,
          "windowEnd" : 773
        },
        "observedSeq" : "GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-9",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-9\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-9</b></p><a name=\"CG-IG-HLA-FullBundle-01-9\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-9\"> </a><a name=\"CG-IG-HLA-FullBundle-01-9-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00002}\">HLA-A*01:02</span></td><td>1014</td><td>1290</td></tr></table><p><b>observedSeq</b>: GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00002"
              }
            ],
            "text" : "HLA-A*01:02"
          },
          "windowStart" : 1014,
          "windowEnd" : 1290
        },
        "observedSeq" : "GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-10",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-10\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-10</b></p><a name=\"CG-IG-HLA-FullBundle-01-10\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-10\"> </a><a name=\"CG-IG-HLA-FullBundle-01-10-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-A*01:01:01G}\">HLA-A*01:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-8200dab6-18a2-4550-b913-a7db480c0804\">HLA-A*01:01:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-7c393185-f15c-45bc-a714-c0fdbea32675\">HLA-A*01:01:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4931}\">HLA-A</span></td></tr></table></div>"
        },
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84414-2",
              "display" : "Haplotype name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
              "version" : "3.23",
              "code" : "HLA-A*01:01:01G",
              "display" : "HLA-A*01:01:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804",
            "type" : "MolecularSequence",
            "display" : "HLA-A*01:01:01:01, exon 2"
          },
          {
            "reference" : "urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675",
            "type" : "MolecularSequence",
            "display" : "HLA-A*01:01:01:01, exon 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4931",
                  "display" : "HLA-A"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-11",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-11\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-11</b></p><a name=\"CG-IG-HLA-FullBundle-01-11\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-11\"> </a><a name=\"CG-IG-HLA-FullBundle-01-11-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-A*01:02}\">HLA-A*01:02</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-65c85f14-c3a0-4b72-818f-820e04fcc621\">HLA-A*01:02, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-fbba9fe7-0ece-4ec1-9233-a437a8d242a0\">HLA-A*01:02, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4931}\">HLA-A</span></td></tr></table></div>"
        },
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84414-2",
              "display" : "Haplotype name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
              "version" : "3.23",
              "code" : "HLA-A*01:02",
              "display" : "HLA-A*01:02"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621",
            "type" : "MolecularSequence",
            "display" : "HLA-A*01:02, exon 2"
          },
          {
            "reference" : "urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0",
            "type" : "MolecularSequence",
            "display" : "HLA-A*01:02, exon 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4931",
                  "display" : "HLA-A"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-12",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-12\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-12</b></p><a name=\"CG-IG-HLA-FullBundle-01-12\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-12\"> </a><a name=\"CG-IG-HLA-FullBundle-01-12-en-US\"> </a><p><b>basedOn</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea\">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84413-4}\">Genotype display name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://glstring.org hla#3.23.0#HLA-A:01:01G+HLA-A*01:02}\">hla#3.23.0#HLA-A:01:01G+HLA-A*01:02</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-b7765bbf-df40-486a-9f2f-404309643de6\">HLA-A*01:01:01G, exons 2 and 3</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-d98d92a7-0e86-4ae5-b036-b7e1bba6ec32\">HLA-A*01:02, exons 2 and 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4931}\">HLA-A</span></td></tr></table></div>"
        },
        "basedOn" : [
          {
            "reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
            "type" : "ServiceRequest",
            "display" : "Class I HLA genotyping for John Storm"
          }
        ],
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84413-4",
              "display" : "Genotype display name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://glstring.org",
              "version" : "1.0",
              "code" : "hla#3.23.0#HLA-A:01:01G+HLA-A*01:02"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6",
            "type" : "Observation",
            "display" : "HLA-A*01:01:01G, exons 2 and 3"
          },
          {
            "reference" : "urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32",
            "type" : "Observation",
            "display" : "HLA-A*01:02, exons 2 and 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4931",
                  "display" : "HLA-A"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-13",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-13\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-13</b></p><a name=\"CG-IG-HLA-FullBundle-01-13\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-13\"> </a><a name=\"CG-IG-HLA-FullBundle-01-13-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00162}\">HLA-B*15:01:01:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00162"
              }
            ],
            "text" : "HLA-B*15:01:01:01"
          },
          "windowStart" : 486,
          "windowEnd" : 756
        },
        "observedSeq" : "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-14",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-14\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-14</b></p><a name=\"CG-IG-HLA-FullBundle-01-14\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-14\"> </a><a name=\"CG-IG-HLA-FullBundle-01-14-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00162}\">HLA-B*15:01:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00162"
              }
            ],
            "text" : "HLA-B*15:01:01:01"
          },
          "windowStart" : 1001,
          "windowEnd" : 1277
        },
        "observedSeq" : "GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-15",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-15\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-15</b></p><a name=\"CG-IG-HLA-FullBundle-01-15\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-15\"> </a><a name=\"CG-IG-HLA-FullBundle-01-15-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00381}\">HLA-B*57:01:01</span></td><td>485</td><td>755</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00381"
              }
            ],
            "text" : "HLA-B*57:01:01"
          },
          "windowStart" : 485,
          "windowEnd" : 755
        },
        "observedSeq" : "GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-16",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-16\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-16</b></p><a name=\"CG-IG-HLA-FullBundle-01-16\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-16\"> </a><a name=\"CG-IG-HLA-FullBundle-01-16-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00381}\">HLA-B*57:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00381"
              }
            ],
            "text" : "HLA-B*57:01:01"
          },
          "windowStart" : 1001,
          "windowEnd" : 1277
        },
        "observedSeq" : "GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-17",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-17\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-17</b></p><a name=\"CG-IG-HLA-FullBundle-01-17\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-17\"> </a><a name=\"CG-IG-HLA-FullBundle-01-17-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HGG00041}\">HLA-B*15:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-cbabf93e-1b4b-46f2-ba1e-d84862670670\">HLA-B*15:01:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-c233ad3d-1572-48d6-93da-0a583535e138\">HLA-B*15:01:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4932}\">HLA-B</span></td></tr></table></div>"
        },
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84414-2",
              "display" : "Haplotype name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
              "version" : "3.23",
              "code" : "HGG00041",
              "display" : "HLA-B*15:01:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670",
            "type" : "MolecularSequence",
            "display" : "HLA-B*15:01:01:01, exon 2"
          },
          {
            "reference" : "urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138",
            "type" : "MolecularSequence",
            "display" : "HLA-B*15:01:01:01, exon 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4932",
                  "display" : "HLA-B"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-18",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-18\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-18</b></p><a name=\"CG-IG-HLA-FullBundle-01-18\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-18\"> </a><a name=\"CG-IG-HLA-FullBundle-01-18-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-B*57:01:01G}\">HLA-B*57:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-05fa52d7-5c67-460a-8722-d3460b24d6fe\">HLA-B*57:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-db69e549-6267-4777-b4b9-8813f3329309\">HLA-B*57:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4932}\">HLA-B</span></td></tr></table></div>"
        },
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84414-2",
              "display" : "Haplotype name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
              "version" : "3.23",
              "code" : "HLA-B*57:01:01G",
              "display" : "HLA-B*57:01:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe",
            "type" : "MolecularSequence",
            "display" : "HLA-B*57:01:01, exon 2"
          },
          {
            "reference" : "urn:uuid:db69e549-6267-4777-b4b9-8813f3329309",
            "type" : "MolecularSequence",
            "display" : "HLA-B*57:01:01, exon 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4932",
                  "display" : "HLA-B"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-19",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-19\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-19</b></p><a name=\"CG-IG-HLA-FullBundle-01-19\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-19\"> </a><a name=\"CG-IG-HLA-FullBundle-01-19-en-US\"> </a><p><b>basedOn</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea\">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84413-4}\">Genotype display name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://glstring.org hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G}\">hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e2092243-2970-49d2-a90f-b90d1d49715a\">HLA-B*15:01:01G, exons 2 and 3</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-792be53e-d4fb-4887-a367-815ef6c706e5\">HLA-B*57:01:01G, exons 2 and 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4932}\">HLA-B</span></td></tr></table></div>"
        },
        "basedOn" : [
          {
            "reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
            "type" : "ServiceRequest",
            "display" : "Class I HLA genotyping for John Storm"
          }
        ],
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84413-4",
              "display" : "Genotype display name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://glstring.org",
              "version" : "1.0",
              "code" : "hla#3.23.0#HLA-B*15:01:01G+HLA-B*57:01:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a",
            "type" : "Observation",
            "display" : "HLA-B*15:01:01G, exons 2 and 3"
          },
          {
            "reference" : "urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5",
            "type" : "Observation",
            "display" : "HLA-B*57:01:01G, exons 2 and 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4932",
                  "display" : "HLA-B"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-20",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-20\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-20</b></p><a name=\"CG-IG-HLA-FullBundle-01-20\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-20\"> </a><a name=\"CG-IG-HLA-FullBundle-01-20-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00401}\">HLA-C*01:02:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00401"
              }
            ],
            "text" : "HLA-C*01:02:01"
          },
          "windowStart" : 486,
          "windowEnd" : 756
        },
        "observedSeq" : "GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-21",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-21\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-21</b></p><a name=\"CG-IG-HLA-FullBundle-01-21\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-21\"> </a><a name=\"CG-IG-HLA-FullBundle-01-21-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00401}\">HLA-C*01:02:01</span></td><td>1002</td><td>1278</td></tr></table><p><b>observedSeq</b>: GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00401"
              }
            ],
            "text" : "HLA-C*01:02:01"
          },
          "windowStart" : 1002,
          "windowEnd" : 1278
        },
        "observedSeq" : "GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-22",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-22\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-22</b></p><a name=\"CG-IG-HLA-FullBundle-01-22\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-22\"> </a><a name=\"CG-IG-HLA-FullBundle-01-22-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00413}\">HLA-C*03:04:01:01</span></td><td>486</td><td>756</td></tr></table><p><b>observedSeq</b>: GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00413"
              }
            ],
            "text" : "HLA-C*03:04:01:01"
          },
          "windowStart" : 486,
          "windowEnd" : 756
        },
        "observedSeq" : "GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
      "resource" : {
        "resourceType" : "MolecularSequence",
        "id" : "CG-IG-HLA-FullBundle-01-23",
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"MolecularSequence_CG-IG-HLA-FullBundle-01-23\"> </a><p class=\"res-header-id\"><b>Generated Narrative: MolecularSequence CG-IG-HLA-FullBundle-01-23</b></p><a name=\"CG-IG-HLA-FullBundle-01-23\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-23\"> </a><a name=\"CG-IG-HLA-FullBundle-01-23-en-US\"> </a><p><b>type</b>: DNA Sequence</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA00413}\">HLA-C*03:04:01:01</span></td><td>1001</td><td>1277</td></tr></table><p><b>observedSeq</b>: GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG</p></div>"
        },
        "type" : "dna",
        "coordinateSystem" : 0,
        "referenceSeq" : {
          "referenceSeqId" : {
            "coding" : [
              {
                "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                "version" : "3.23",
                "code" : "HLA00413"
              }
            ],
            "text" : "HLA-C*03:04:01:01"
          },
          "windowStart" : 1001,
          "windowEnd" : 1277
        },
        "observedSeq" : "GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"
      },
      "request" : {
        "method" : "POST",
        "url" : "MolecularSequence"
      }
    },
    {
      "fullUrl" : "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-24",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-24\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-24</b></p><a name=\"CG-IG-HLA-FullBundle-01-24\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-24\"> </a><a name=\"CG-IG-HLA-FullBundle-01-24-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-C*01:02:01G}\">HLA-C*01:02:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0\">HLA-C*01:02:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-46938bb2-0486-4e87-bfd3-89aab2d5e22f\">HLA-C*01:02:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4933}\">HLA-C</span></td></tr></table></div>"
        },
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84414-2",
              "display" : "Haplotype name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
              "version" : "3.23",
              "code" : "HLA-C*01:02:01G",
              "display" : "HLA-C*01:02:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0",
            "type" : "MolecularSequence",
            "display" : "HLA-C*01:02:01, exon 2"
          },
          {
            "reference" : "urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f",
            "type" : "MolecularSequence",
            "display" : "HLA-C*01:02:01, exon 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4933",
                  "display" : "HLA-C"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-25",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/haplotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-25\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-25</b></p><a name=\"CG-IG-HLA-FullBundle-01-25\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-25\"> </a><a name=\"CG-IG-HLA-FullBundle-01-25-en-US\"> </a><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84414-2}\">Haplotype name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://www.ebi.ac.uk/ipd/imgt/hla HLA-C*01:02:01G}\">HLA-C*01:02:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-2ae2ff34-279e-43c2-9018-b054fd3fc1ce\">HLA-C*03:04:01:01, exon 2</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-19153ef1-68c6-47a2-9676-c4eefbd39af9\">HLA-C*03:04:01:01, exon 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4933}\">HLA-C</span></td></tr></table></div>"
        },
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84414-2",
              "display" : "Haplotype name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
              "version" : "3.23",
              "code" : "HLA-C*01:02:01G",
              "display" : "HLA-C*01:02:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce",
            "type" : "MolecularSequence",
            "display" : "HLA-C*03:04:01:01, exon 2"
          },
          {
            "reference" : "urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9",
            "type" : "MolecularSequence",
            "display" : "HLA-C*03:04:01:01, exon 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4933",
                  "display" : "HLA-C"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
      "resource" : {
        "resourceType" : "Observation",
        "id" : "CG-IG-HLA-FullBundle-01-26",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genotype"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_CG-IG-HLA-FullBundle-01-26\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation CG-IG-HLA-FullBundle-01-26</b></p><a name=\"CG-IG-HLA-FullBundle-01-26\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-26\"> </a><a name=\"CG-IG-HLA-FullBundle-01-26-en-US\"> </a><p><b>basedOn</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-99309303-045e-4cf4-90d7-250d7a7476ea\">Class I HLA genotyping for John Storm</a></p><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 84413-4}\">Genotype display name</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-13f34265-335c-4853-bc38-0815315edafa\">John Storm</a></p><p><b>effective</b>: 2016-12-15</p><p><b>performer</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab, Inc</a></p><p><b>value</b>: <span title=\"Codes:{http://glstring.org hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G}\">hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G</span></p><p><b>method</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/gtr GTR000000000.0}\">NGS based Class I HLA-A, -B, -C genotyping</span></p><p><b>specimen</b>: <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-e44fbe33-6084-4ae2-a95e-8bc451c63340\">buccal swab from John Storm</a></p><p><b>derivedFrom</b>: </p><ul><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-8b2aa21c-1426-4717-8ab0-a84d83df7d47\">HLA-C*03:04:01G, exons 2 and 3</a></li><li><a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-709c5315-9403-4867-9d82-0b953836665f\">HLA-C*01:02:01G, exons 2 and 3</a></li></ul><h3>Components</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Code</b></td><td><b>Value[x]</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></td><td><span title=\"Codes:{http://www.genenames.org HGNC:4933}\">HLA-C</span></td></tr></table></div>"
        },
        "basedOn" : [
          {
            "reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
            "type" : "ServiceRequest",
            "display" : "Class I HLA genotyping for John Storm"
          }
        ],
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/observation-category",
                "code" : "laboratory"
              }
            ]
          },
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "84413-4",
              "display" : "Genotype display name"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "display" : "aTypingLab, Inc"
          }
        ],
        "valueCodeableConcept" : {
          "coding" : [
            {
              "system" : "http://glstring.org",
              "version" : "1.0",
              "code" : "hla#3.23.0#HLA-C*01:02:01G+HLA-C*03:04:01G"
            }
          ]
        },
        "method" : {
          "coding" : [
            {
              "system" : "http://www.ncbi.nlm.nih.gov/gtr",
              "code" : "GTR000000000.0"
            }
          ],
          "text" : "NGS based Class I HLA-A, -B, -C genotyping"
        },
        "specimen" : {
          "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
          "display" : "buccal swab from John Storm"
        },
        "derivedFrom" : [
          {
            "reference" : "urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47",
            "type" : "Observation",
            "display" : "HLA-C*03:04:01G, exons 2 and 3"
          },
          {
            "reference" : "urn:uuid:709c5315-9403-4867-9d82-0b953836665f",
            "type" : "Observation",
            "display" : "HLA-C*01:02:01G, exons 2 and 3"
          }
        ],
        "component" : [
          {
            "code" : {
              "coding" : [
                {
                  "system" : "http://loinc.org",
                  "code" : "48018-6",
                  "display" : "Gene studied [ID]"
                }
              ]
            },
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.genenames.org",
                  "code" : "HGNC:4933",
                  "display" : "HLA-C"
                }
              ]
            }
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "Observation"
      }
    },
    {
      "fullUrl" : "urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9",
      "resource" : {
        "resourceType" : "DiagnosticReport",
        "id" : "CG-IG-HLA-FullBundle-01-27",
        "meta" : {
          "profile" : [
            🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report"
          ]
        },
        "text" : {
          "status" : "generated",
          "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"DiagnosticReport_CG-IG-HLA-FullBundle-01-27\"> </a><p class=\"res-header-id\"><b>Generated Narrative: DiagnosticReport CG-IG-HLA-FullBundle-01-27</b></p><a name=\"CG-IG-HLA-FullBundle-01-27\"> </a><a name=\"hcCG-IG-HLA-FullBundle-01-27\"> </a><a name=\"CG-IG-HLA-FullBundle-01-27-en-US\"> </a><h2><span title=\"Codes:{http://loinc.org 51969-4}, {http://www.genenames.org HGNC:588}\">Genetic analysis report</span> (<span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span>) </h2><table class=\"grid\"><tr><td>Subject</td><td>Not done yet</td></tr><tr><td>When For</td><td>2016-12-15</td></tr><tr><td>Reported</td><td>2016-12-15 14:15:30-0600</td></tr><tr><td>Performer</td><td> <a href=\"Bundle-bundle-CG-IG-HLA-FullBundle-01.html#urn-uuid-9243cc20-27bd-4f87-ba90-0328ed474950\">aTypingLab Inc</a></td></tr></table><p><b>Report Details</b></p><table class=\"grid\"><tr><td><b>Code</b></td><td><b>Value</b></td></tr><tr><td/><td/></tr><tr><td/><td/></tr><tr><td/><td/></tr></table></div>"
        },
        "extension" : [
          {
            "url" : "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database",
            "valueCodeableConcept" : {
              "coding" : [
                {
                  "system" : "http://www.ebi.ac.uk/ipd/imgt/hla",
                  "version" : "3.23"
                }
              ]
            }
          },
          {
            "extension" : [
              {
                "url" : "text",
                "valueString" : "HLA-A*01:01:01G+HLA-A*01:02^HLA-B*15:01:01G+HLA-B*57:01:01G^HLA-C*01:02:01G+HLA-C*03:04:01G"
              },
              {
                "url" : "url",
                "valueUri" : "https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/ex"
              }
            ],
            "url" : "http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring"
          }
        ],
        "basedOn" : [
          {
            "reference" : "urn:uuid:99309303-045e-4cf4-90d7-250d7a7476ea",
            "type" : "ServiceRequest",
            "display" : "Class I HLA genotyping for John Storm"
          }
        ],
        "status" : "final",
        "category" : [
          {
            "coding" : [
              {
                "system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
                "code" : "GE",
                "display" : "Genetics"
              }
            ]
          }
        ],
        "code" : {
          "coding" : [
            {
              "system" : "http://loinc.org",
              "code" : "51969-4",
              "display" : "Genetic analysis report"
            },
            {
              "system" : "http://www.genenames.org",
              "code" : "HGNC:588",
              "display" : "Histocompatibility complex (HLA)"
            }
          ]
        },
        "subject" : {
          "reference" : "urn:uuid:13f34265-335c-4853-bc38-0815315edafa",
          "type" : "Patient",
          "display" : "John Storm"
        },
        "effectiveDateTime" : "2016-12-15",
        "issued" : "2016-12-15T14:15:30-06:00",
        "performer" : [
          {
            "reference" : "urn:uuid:9243cc20-27bd-4f87-ba90-0328ed474950",
            "type" : "Organization",
            "display" : "aTypingLab Inc"
          }
        ],
        "specimen" : [
          {
            "reference" : "urn:uuid:e44fbe33-6084-4ae2-a95e-8bc451c63340",
            "display" : "buccal swab from John Storm"
          }
        ],
        "result" : [
          {
            "reference" : "urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228",
            "type" : "Observation",
            "display" : "HLA-A: HLA-A:01:01:01G+HLA-A*01:02"
          },
          {
            "reference" : "urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70",
            "type" : "Observation",
            "display" : "HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G"
          },
          {
            "reference" : "urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208",
            "type" : "Observation",
            "display" : "HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G"
          }
        ]
      },
      "request" : {
        "method" : "POST",
        "url" : "DiagnosticReport"
      }
    }
  ]
}