Genomics Reporting Implementation Guide
3.0.1-SNAPSHOT - Ballot International flag

Genomics Reporting Implementation Guide, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 3.0.1-SNAPSHOT built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/genomics-reporting/ and changes regularly. See the Directory of published versions

Example Bundle: bundle-oncology-report-example

Bundle bundle-oncology-report-example of type transaction


Entry 1 - fullUrl = urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

Request:

POST Organization
If-None-Exist = identifier=http://molit.eu/fhir/genomics/NamingSystem/organization|CEGAT

Resource Organization:

Generated Narrative: Organization

ResourceOrganization "Inline-Instance-for-oncology-report-example-1"

identifier: http://molit.eu/fhir/genomics/NamingSystem/organization/CEGAT

name: CEGAT


Entry 2 - fullUrl = urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

Request:

POST Patient
If-None-Exist = identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/patID|11111

Resource Patient:

null, DoB: ( http://molit.eu/fhir/genomics/NamingSystem/cegat/patID#11111)


Entry 3 - fullUrl = urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516

Request:

POST Specimen
If-None-Exist = identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID|UNKNOWN

Resource Specimen:

Generated Narrative: Specimen

ResourceSpecimen "Inline-Instance-for-oncology-report-example-3"

identifier: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

type: Tumor (specimenType#TUMOR)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

Collections

-MethodBodySite
*Biopsy ()Malignant neoplasm of cardia (International Classification of Diseases, 10th Revision, Clinical Modification (ICD-10-CM)#C16.0)


Entry 4 - fullUrl = urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-4"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: PIK3CA (HUGO Gene Nomenclature Committee Genes#HGNC:8975)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_006218.4:c.3140A>G (Human Genome Variation Society nomenclature#NM_006218.4:c.3140A>G)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Amino acid change (pHGVS) (LOINC#48005-3)

value: NP_006209.2:p.His1047Arg (Human Genome Variation Society nomenclature#NP_006209.2:p.His1047Arg)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_006218.4 (Gene Reference Sequence Collection#NM_006218.3)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: A

component

code: Sample VAF (LOINC#81258-6)

value: 0.2188 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 64 reads per base pair (Details: UCUM code 1 = '1')


Entry 5 - fullUrl = urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-5"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: NRAS (HUGO Gene Nomenclature Committee Genes#HGNC:7989)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_002524.4:c.34G>T (Human Genome Variation Society nomenclature#NM_002524.4:c.34G>T)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_002524.4 (Gene Reference Sequence Collection#NM_002524.4)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: C

component

code: Sample VAF (LOINC#81258-6)

value: 0.1793 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 145 reads per base pair (Details: UCUM code 1 = '1')


Entry 6 - fullUrl = urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-6"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: FBXW7 (HUGO Gene Nomenclature Committee Genes#HGNC:16712)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_001349798.2:c.1394G>A (Human Genome Variation Society nomenclature#NM_001349798.2:c.1394G>A)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Amino acid change (pHGVS) (LOINC#48005-3)

value: NP_001336727.1:p.Arg465His (Human Genome Variation Society nomenclature#NP_001336727.1:p.Arg465His)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_001349798.2 (Gene Reference Sequence Collection#NM_001349798.2)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: C

component

code: Sample VAF (LOINC#81258-6)

value: 0.1053 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 57 reads per base pair (Details: UCUM code 1 = '1')


Entry 7 - fullUrl = urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-7"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: KMT2D (HUGO Gene Nomenclature Committee Genes#HGNC:7133)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_003482.3:c.7900_7901delCA (Human Genome Variation Society nomenclature#NM_003482.3:c.7900_7901delCA)

component

code: DNA change type (LOINC#48019-4)

value: deletion (sequenceontology.org#SO:0000159)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_003482.3 (Gene Reference Sequence Collection#NM_003482.3)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: CTG

component

code: Sample VAF (LOINC#81258-6)

value: 0.188 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 117 reads per base pair (Details: UCUM code 1 = '1')


Entry 8 - fullUrl = urn:uuid:58828523-8893-45fc-973b-16290366c5e5

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-8"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: PIK3CA (HUGO Gene Nomenclature Committee Genes#HGNC:8975)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_006218.3:c.333G>T (Human Genome Variation Society nomenclature#NM_006218.3:c.333G>T)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_006218.3 (Gene Reference Sequence Collection#NM_006218.3)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: G

component

code: Sample VAF (LOINC#81258-6)

value: 0.1471 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 68 reads per base pair (Details: UCUM code 1 = '1')


Entry 9 - fullUrl = urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-9"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: IRS2 (HUGO Gene Nomenclature Committee Genes#HGNC:6126)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_003749.2:c.3960C>T (Human Genome Variation Society nomenclature#NM_003749.2:c.3960C>T)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_003749.2 (Gene Reference Sequence Collection#NM_003749.2)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: G

component

code: Sample VAF (LOINC#81258-6)

value: 0.1343 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 134 reads per base pair (Details: UCUM code 1 = '1')


Entry 10 - fullUrl = urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-10"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: CDKN2A (HUGO Gene Nomenclature Committee Genes#HGNC:1787)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_000077.4:c.9_32del (Human Genome Variation Society nomenclature#NM_000077.4:c.9_32del)

component

code: DNA change type (LOINC#48019-4)

value: deletion (sequenceontology.org#SO:0000159)

component

code: Amino acid change (pHGVS) (LOINC#48005-3)

value: NP_000068.1:p.Ala4_Pro11del (Human Genome Variation Society nomenclature#NP_000068.1:p.Ala4_Pro11del)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_000077.4 (Gene Reference Sequence Collection#NM_000077.4)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: AGGCTCCATGCTGCTCCCCGCCGCC

component

code: Sample VAF (LOINC#81258-6)

value: 0.0536 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 112 reads per base pair (Details: UCUM code 1 = '1')


Entry 11 - fullUrl = urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-11"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: RECQL4 (HUGO Gene Nomenclature Committee Genes#HGNC:9949)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_004260.4:c.2086C>T (Human Genome Variation Society nomenclature#NM_004260.4:c.2086C>T)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Amino acid change (pHGVS) (LOINC#48005-3)

value: NP_004251.4:p.Arg696Cys (Human Genome Variation Society nomenclature#NP_004251.4:p.Arg696Cys)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_004260.4 (Gene Reference Sequence Collection#NM_004260.4)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: G

component

code: Sample VAF (LOINC#81258-6)

value: 0.2568 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 148 reads per base pair (Details: UCUM code 1 = '1')


Entry 12 - fullUrl = urn:uuid:c3587931-242f-4129-93f9-be24500c8f29

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-12"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: RYR1 (HUGO Gene Nomenclature Committee Genes#HGNC:10483)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_000540.3:c.4964G>A (Human Genome Variation Society nomenclature#NM_000540.3:c.4964G>A)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Amino acid change (pHGVS) (LOINC#48005-3)

value: NP_000531.2:p.Arg1655Leu (Human Genome Variation Society nomenclature#NP_000531.2:p.Arg1655Leu)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_000540.3 (Gene Reference Sequence Collection#NM_000540.2)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: G

component

code: Sample VAF (LOINC#81258-6)

value: 0.2151 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 93 reads per base pair (Details: UCUM code 1 = '1')


Entry 13 - fullUrl = urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-13"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: SACS (HUGO Gene Nomenclature Committee Genes#HGNC:10519)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_014363.5:c.12118G>A (Human Genome Variation Society nomenclature#NM_014363.5:c.12118G>A)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_014363.5 (Gene Reference Sequence Collection#NM_014363.5)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: C

component

code: Sample VAF (LOINC#81258-6)

value: 0.3333 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 60 reads per base pair (Details: UCUM code 1 = '1')


Entry 14 - fullUrl = urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-14"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: SLIT2 (HUGO Gene Nomenclature Committee Genes#HGNC:11086)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_004787.3:c.1290C>A (Human Genome Variation Society nomenclature#NM_004787.3:c.1290C>A)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_004787.3 (Gene Reference Sequence Collection#NM_004787.3)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: C

component

code: Sample VAF (LOINC#81258-6)

value: 0.2642 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 53 reads per base pair (Details: UCUM code 1 = '1')


Entry 15 - fullUrl = urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca

Request:

POST Observation

Resource Observation:

Generated Narrative: Observation

ResourceObservation "Inline-Instance-for-oncology-report-example-15"

Profile: Variant

status: FINAL

category: Laboratory (Observation Category Codes#laboratory), Genetics (diagnosticServiceSectionId#GE)

code: Genetic variant assessment (LOINC#69548-6)

subject: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648

effective: 2023-03-05

performer: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17

value: Present (LOINC#LA9633-4)

method: Sequencing (LOINC#LA26398-0)

specimen: http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID/UNKNOWN

component

code: Genomic source class (LOINC#48002-0)

value: Somatic (LOINC#LA6684-0)

component

code: Gene studied [ID] (LOINC#48018-6)

value: SMARCA4 (HUGO Gene Nomenclature Committee Genes#HGNC:11100)

component

code: Human reference sequence assembly version (LOINC#62374-4)

value: GRCh37 (LOINC#LA14029-5)

component

code: DNA change (c.HGVS) (LOINC#48004-6)

value: NM_003072.5:c.2372C>T (Human Genome Variation Society nomenclature#NM_003072.5:c.2372C>T)

component

code: DNA change type (LOINC#48019-4)

value: substitution (sequenceontology.org#SO:1000002)

component

code: Amino acid change (pHGVS) (LOINC#48005-3)

value: NP_003063.2:p.Ala791Val (Human Genome Variation Society nomenclature#NP_003063.2:p.Ala791Val)

component

code: Transcript reference sequence [ID] (LOINC#51958-7)

value: NM_003072.5 (Gene Reference Sequence Collection#NM_003072.5)

component

code: Genomic ref allele [ID] (LOINC#69547-8)

value: C

component

code: Sample VAF (LOINC#81258-6)

value: 0.1938 relative frequency of a particular allele in the specimen (Details: UCUM code 1 = '1')

component

code: Allelic read depth (LOINC#82121-5)

value: 160 reads per base pair (Details: UCUM code 1 = '1')


Entry 16 - fullUrl = urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa

Request:

POST DiagnosticReport

Resource DiagnosticReport:

Genetic analysis report (Genetics)

SubjectNot done yet
Reported2019-09-15 11:35:05-0400
Identifier: http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID/42867

Report Details

CodeValueWhen For
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05
Genetic variant assessmentPresent2023-03-05