Genomics Reporting Implementation Guide, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 3.0.1-SNAPSHOT built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/genomics-reporting/ and changes regularly. See the Directory of published versions
{
"resourceType" : "Bundle",
"id" : "bundle-oncology-report-example",
"type" : "transaction",
"entry" : [
{
"fullUrl" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17",
"resource" : {
"resourceType" : "Organization",
"id" : "Inline-Instance-for-oncology-report-example-1",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Organization_Inline-Instance-for-oncology-report-example-1\"> </a><p><b>Generated Narrative: Organization</b><a name=\"Inline-Instance-for-oncology-report-example-1\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-1\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Organization "Inline-Instance-for-oncology-report-example-1" </p></div><p><b>identifier</b>: <code>http://molit.eu/fhir/genomics/NamingSystem/organization</code>/CEGAT</p><p><b>name</b>: CEGAT</p></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/organization",
"value" : "CEGAT"
}
],
"name" : "CEGAT"
},
"request" : {
"method" : "POST",
"url" : "Organization",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/organization|CEGAT"
}
},
{
"fullUrl" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648",
"resource" : {
"resourceType" : "Patient",
"id" : "Inline-Instance-for-oncology-report-example-2",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Patient_Inline-Instance-for-oncology-report-example-2\"> </a><p><b>Generated Narrative: Patient</b><a name=\"Inline-Instance-for-oncology-report-example-2\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-2\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Patient "Inline-Instance-for-oncology-report-example-2" </p></div><p><b>identifier</b>: <code>http://molit.eu/fhir/genomics/NamingSystem/cegat/patID</code>/11111</p></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/patID",
"value" : "11111"
}
]
},
"request" : {
"method" : "POST",
"url" : "Patient",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/patID|11111"
}
},
{
"fullUrl" : "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516",
"resource" : {
"resourceType" : "Specimen",
"id" : "Inline-Instance-for-oncology-report-example-3",
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Specimen_Inline-Instance-for-oncology-report-example-3\"> </a><p><b>Generated Narrative: Specimen</b><a name=\"Inline-Instance-for-oncology-report-example-3\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-3\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Specimen "Inline-Instance-for-oncology-report-example-3" </p></div><p><b>identifier</b>: <code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><p><b>type</b>: Tumor <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0487.html\">specimenType</a>#TUMOR)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><h3>Collections</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Method</b></td><td><b>BodySite</b></td></tr><tr><td style=\"display: none\">*</td><td>Biopsy <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> ()</span></td><td>Malignant neoplasm of cardia <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-icd10CM.html\">International Classification of Diseases, 10th Revision, Clinical Modification (ICD-10-CM)</a>#C16.0)</span></td></tr></table></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
],
"type" : {
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0487",
"code" : "TUMOR",
"display" : "Tumor"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"collection" : {
"method" : {
"text" : "Biopsy"
},
"bodySite" : {
"coding" : [
{
"system" : "http://hl7.org/fhir/sid/icd-10-cm",
"code" : "C16.0"
}
]
}
}
},
"request" : {
"method" : "POST",
"url" : "Specimen",
"ifNoneExist" : "identifier=http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID|UNKNOWN"
}
},
{
"fullUrl" : "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-4",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-4\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-4\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-4\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-4" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:8975)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_006218.4:c.3140A>G <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_006218.4:c.3140A>G)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_006209.2:p.His1047Arg <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_006209.2:p.His1047Arg)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_006218.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_006218.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: A</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 64 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:8975",
"display" : "PIK3CA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_006218.4:c.3140A>G",
"display" : "NM_006218.4:c.3140A>G"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NP_006209.2:p.His1047Arg",
"display" : "NP_006209.2:p.His1047Arg"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_006218.3",
"display" : "NM_006218.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "A"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2188,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 64,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-5",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-5\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-5\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-5\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-5" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: NRAS <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:7989)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_002524.4:c.34G>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_002524.4:c.34G>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_002524.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_002524.4)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1793 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 145 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:7989",
"display" : "NRAS"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_002524.4:c.34G>T",
"display" : "NM_002524.4:c.34G>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_002524.4",
"display" : "NM_002524.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1793,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 145,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-6",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-6\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-6\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-6\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-6" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: FBXW7 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:16712)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_001349798.2:c.1394G>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_001349798.2:c.1394G>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_001336727.1:p.Arg465His <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_001336727.1:p.Arg465His)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_001349798.2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_001349798.2)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1053 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 57 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:16712",
"display" : "FBXW7"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_001349798.2:c.1394G>A",
"display" : "NM_001349798.2:c.1394G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NP_001336727.1:p.Arg465His",
"display" : "NP_001336727.1:p.Arg465His"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_001349798.2",
"display" : "NM_001349798.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1053,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 57,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-7",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-7\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-7\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-7\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-7" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: KMT2D <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:7133)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_003482.3:c.7900_7901delCA <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_003482.3:c.7900_7901delCA)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:0000159)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_003482.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_003482.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: CTG</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 117 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:7133",
"display" : "KMT2D"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_003482.3:c.7900_7901delCA",
"display" : "NM_003482.3:c.7900_7901delCA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:0000159",
"display" : "deletion"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003482.3",
"display" : "NM_003482.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "CTG"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.188,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 117,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:58828523-8893-45fc-973b-16290366c5e5",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-8",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-8\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-8\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-8\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-8" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: PIK3CA <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:8975)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_006218.3:c.333G>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_006218.3:c.333G>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_006218.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_006218.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1471 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 68 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:8975",
"display" : "PIK3CA"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_006218.3:c.333G>T",
"display" : "NM_006218.3:c.333G>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_006218.3",
"display" : "NM_006218.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1471,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 68,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-9",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-9\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-9\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-9\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-9" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: IRS2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:6126)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_003749.2:c.3960C>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_003749.2:c.3960C>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_003749.2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_003749.2)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1343 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 134 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:6126",
"display" : "IRS2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_003749.2:c.3960C>T",
"display" : "NM_003749.2:c.3960C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003749.2",
"display" : "NM_003749.2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1343,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 134,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-10",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-10\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-10\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-10\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-10" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: CDKN2A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:1787)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_000077.4:c.9_32del <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_000077.4:c.9_32del)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: deletion <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:0000159)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_000068.1:p.Ala4_Pro11del <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_000068.1:p.Ala4_Pro11del)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_000077.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_000077.4)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: AGGCTCCATGCTGCTCCCCGCCGCC</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.0536 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 112 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:1787",
"display" : "CDKN2A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_000077.4:c.9_32del"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:0000159",
"display" : "deletion"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NP_000068.1:p.Ala4_Pro11del"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_000077.4",
"display" : "NM_000077.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "AGGCTCCATGCTGCTCCCCGCCGCC"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.0536,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 112,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-11",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-11\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-11\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-11\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-11" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: RECQL4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:9949)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_004260.4:c.2086C>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_004260.4:c.2086C>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_004251.4:p.Arg696Cys <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_004251.4:p.Arg696Cys)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_004260.4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_004260.4)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2568 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 148 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:9949",
"display" : "RECQL4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_004260.4:c.2086C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NP_004251.4:p.Arg696Cys"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_004260.4",
"display" : "NM_004260.4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2568,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 148,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-12",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-12\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-12\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-12\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-12" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: RYR1 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:10483)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_000540.3:c.4964G>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_000540.3:c.4964G>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_000531.2:p.Arg1655Leu <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_000531.2:p.Arg1655Leu)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_000540.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_000540.2)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2151 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 93 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:10483",
"display" : "RYR1"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_000540.3:c.4964G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NP_000531.2:p.Arg1655Leu"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_000540.2",
"display" : "NM_000540.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "G"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2151,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 93,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-13",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-13\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-13\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-13\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-13" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: SACS <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:10519)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_014363.5:c.12118G>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_014363.5:c.12118G>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_014363.5 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_014363.5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.3333 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 60 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:10519",
"display" : "SACS"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_014363.5:c.12118G>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_014363.5",
"display" : "NM_014363.5"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.3333,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 60,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-14",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-14\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-14\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-14\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-14" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: SLIT2 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:11086)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_004787.3:c.1290C>A <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_004787.3:c.1290C>A)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_004787.3 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_004787.3)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.2642 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 53 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:11086",
"display" : "SLIT2"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_004787.3:c.1290C>A"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_004787.3",
"display" : "NM_004787.3"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.2642,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 53,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca",
"resource" : {
"resourceType" : "Observation",
"id" : "Inline-Instance-for-oncology-report-example-15",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-15\"> </a><p><b>Generated Narrative: Observation</b><a name=\"Inline-Instance-for-oncology-report-example-15\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-15\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource Observation "Inline-Instance-for-oncology-report-example-15" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: final</p><p><b>category</b>: Laboratory <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-observation-category.html\">Observation Category Codes</a>#laboratory)</span>, Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic variant assessment <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69548-6)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>value</b>: Present <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA9633-4)</span></p><p><b>method</b>: Sequencing <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA26398-0)</span></p><p><b>specimen</b>: <span><code>http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</span></p><blockquote><p><b>component</b></p><p><b>code</b>: Genomic source class <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48002-0)</span></p><p><b>value</b>: Somatic <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA6684-0)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Gene studied [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48018-6)</span></p><p><b>value</b>: SMARCA4 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgnc.html\">HUGO Gene Nomenclature Committee Genes</a>#HGNC:11100)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Human reference sequence assembly version <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#62374-4)</span></p><p><b>value</b>: GRCh37 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#LA14029-5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change (c.HGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48004-6)</span></p><p><b>value</b>: NM_003072.5:c.2372C>T <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NM_003072.5:c.2372C>T)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: DNA change type <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48019-4)</span></p><p><b>value</b>: substitution <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (sequenceontology.org#SO:1000002)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Amino acid change (pHGVS) <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#48005-3)</span></p><p><b>value</b>: NP_003063.2:p.Ala791Val <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-hgvs.html\">Human Genome Variation Society nomenclature</a>#NP_003063.2:p.Ala791Val)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Transcript reference sequence [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51958-7)</span></p><p><b>value</b>: NM_003072.5 <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v3-refSeq.html\">Gene Reference Sequence Collection</a>#NM_003072.5)</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Genomic ref allele [ID] <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#69547-8)</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Sample VAF <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#81258-6)</span></p><p><b>value</b>: 0.1938 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: Allelic read depth <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#82121-5)</span></p><p><b>value</b>: 160 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code 1 = '1')</span></p></blockquote></div>"
},
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/observation-category",
"code" : "laboratory"
}
]
},
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69548-6",
"display" : "Genetic variant assessment"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"effectiveDateTime" : "2023-03-05",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA9633-4",
"display" : "Present"
}
]
},
"method" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA26398-0",
"display" : "Sequencing"
}
]
},
"specimen" : {
"identifier" : {
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/tissueID",
"value" : "UNKNOWN"
}
},
"component" : [
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48002-0",
"display" : "Genomic source class"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA6684-0",
"display" : "Somatic"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48018-6",
"display" : "Gene studied [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.genenames.org",
"code" : "HGNC:11100",
"display" : "SMARCA4"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "62374-4",
"display" : "Human reference sequence assembly version"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "LA14029-5",
"display" : "GRCh37"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48004-6",
"display" : "DNA change (c.HGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NM_003072.5:c.2372C>T"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48019-4",
"display" : "DNA change type"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://sequenceontology.org",
"code" : "SO:1000002",
"display" : "substitution"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "48005-3",
"display" : "Amino acid change (pHGVS)"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://varnomen.hgvs.org",
"code" : "NP_003063.2:p.Ala791Val"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51958-7",
"display" : "Transcript reference sequence [ID]"
}
]
},
"valueCodeableConcept" : {
"coding" : [
{
"system" : "http://www.ncbi.nlm.nih.gov/refseq",
"code" : "NM_003072.5",
"display" : "NM_003072.5"
}
]
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "69547-8",
"display" : "Genomic ref allele [ID]"
}
]
},
"valueString" : "C"
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "81258-6",
"display" : "Sample VAF"
}
]
},
"valueQuantity" : {
"value" : 0.1938,
"unit" : "relative frequency of a particular allele in the specimen",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
},
{
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "82121-5",
"display" : "Allelic read depth"
}
]
},
"valueQuantity" : {
"value" : 160,
"unit" : "reads per base pair",
"system" : "http://unitsofmeasure.org",
"code" : "1"
}
}
]
},
"request" : {
"method" : "POST",
"url" : "Observation"
}
},
{
"fullUrl" : "urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa",
"resource" : {
"resourceType" : "DiagnosticReport",
"id" : "Inline-Instance-for-oncology-report-example-16",
"meta" : {
"profile" : [
🔗 "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report"
]
},
"text" : {
"status" : "generated",
"div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"DiagnosticReport_Inline-Instance-for-oncology-report-example-16\"> </a><p><b>Generated Narrative: DiagnosticReport</b><a name=\"Inline-Instance-for-oncology-report-example-16\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-16\"> </a></p><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Resource DiagnosticReport "Inline-Instance-for-oncology-report-example-16" </p><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-genomic-report.html\">Genomic Report</a></p></div><p><b>identifier</b>: <code>http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID</code>/42867</p><p><b>status</b>: final</p><p><b>category</b>: Genetics <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"http://terminology.hl7.org/5.3.0/CodeSystem-v2-0074.html\">diagnosticServiceSectionId</a>#GE)</span></p><p><b>code</b>: Genetic analysis report <span style=\"background: LightGoldenRodYellow; margin: 4px; border: 1px solid khaki\"> (<a href=\"https://loinc.org/\">LOINC</a>#51969-4)</span></p><p><b>subject</b>: See on this page: urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648</p><p><b>issued</b>: Sep 15, 2019, 3:35:05\u202fPM</p><p><b>performer</b>: See on this page: urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17</p><p><b>specimen</b>: See on this page: urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516</p><p><b>result</b>: </p><ul><li>See on this page: urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae</li><li>See on this page: urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00</li><li>See on this page: urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5</li><li>See on this page: urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358</li><li>See on this page: urn:uuid:58828523-8893-45fc-973b-16290366c5e5</li><li>See on this page: urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2</li><li>See on this page: urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1</li><li>See on this page: urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf</li><li>See on this page: urn:uuid:c3587931-242f-4129-93f9-be24500c8f29</li><li>See on this page: urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6</li><li>See on this page: urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2</li><li>See on this page: urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca</li></ul></div>"
},
"identifier" : [
{
"system" : "http://molit.eu/fhir/genomics/NamingSystem/cegat/reportID",
"value" : "42867"
}
],
"status" : "final",
"category" : [
{
"coding" : [
{
"system" : "http://terminology.hl7.org/CodeSystem/v2-0074",
"code" : "GE"
}
]
}
],
"code" : {
"coding" : [
{
"system" : "http://loinc.org",
"code" : "51969-4",
"display" : "Genetic analysis report"
}
]
},
"subject" : {
"reference" : "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648"
},
"issued" : "2019-09-15T11:35:05.722-04:00",
"performer" : [
{
"reference" : "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17"
}
],
"specimen" : [
{
"reference" : "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516"
}
],
"result" : [
{
"reference" : "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae"
},
{
"reference" : "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00"
},
{
"reference" : "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5"
},
{
"reference" : "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358"
},
{
"reference" : "urn:uuid:58828523-8893-45fc-973b-16290366c5e5"
},
{
"reference" : "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2"
},
{
"reference" : "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1"
},
{
"reference" : "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf"
},
{
"reference" : "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29"
},
{
"reference" : "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6"
},
{
"reference" : "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2"
},
{
"reference" : "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca"
}
]
},
"request" : {
"method" : "POST",
"url" : "DiagnosticReport"
}
}
]
}