Genomics Reporting Implementation Guide, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 4.0.0-cibuild built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/genomics-reporting/ and changes regularly. See the Directory of published versions
@prefix fhir: <http://hl7.org/fhir/> . @prefix loinc: <http://loinc.org/rdf#> . @prefix owl: <http://www.w3.org/2002/07/owl#> . @prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . @prefix xsd: <http://www.w3.org/2001/XMLSchema#> . # - resource ------------------------------------------------------------------- <http://hl7.org/fhir/Bundle/bundle-oncology-report-example> a fhir:Bundle ; fhir:nodeRole fhir:treeRoot ; fhir:Resource.id [ fhir:value "bundle-oncology-report-example"] ; fhir:Bundle.type [ fhir:value "transaction"] ; fhir:Bundle.entry [ fhir:index 0 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ; fhir:Bundle.entry.resource <urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Organization" ] ; fhir:Bundle.entry.request.ifNoneExist [ fhir:value "identifier=http://example.org/genomics/NamingSystem/organization|CEGAT" ] ] ], [ fhir:index 1 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ; fhir:Bundle.entry.resource <urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Patient" ] ; fhir:Bundle.entry.request.ifNoneExist [ fhir:value "identifier=http://example.org/genomics/NamingSystem/cegat/patID|11111" ] ] ], [ fhir:index 2 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516" ] ; fhir:Bundle.entry.resource <urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Specimen" ] ; fhir:Bundle.entry.request.ifNoneExist [ fhir:value "identifier=http://example.org/genomics/NamingSystem/cegat/tissueID|UNKNOWN" ] ] ], [ fhir:index 3 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae" ] ; fhir:Bundle.entry.resource <urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 4 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00" ] ; fhir:Bundle.entry.resource <urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 5 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5" ] ; fhir:Bundle.entry.resource <urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 6 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358" ] ; fhir:Bundle.entry.resource <urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 7 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:58828523-8893-45fc-973b-16290366c5e5" ] ; fhir:Bundle.entry.resource <urn:uuid:58828523-8893-45fc-973b-16290366c5e5> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 8 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2" ] ; fhir:Bundle.entry.resource <urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 9 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1" ] ; fhir:Bundle.entry.resource <urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 10 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf" ] ; fhir:Bundle.entry.resource <urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 11 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29" ] ; fhir:Bundle.entry.resource <urn:uuid:c3587931-242f-4129-93f9-be24500c8f29> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 12 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6" ] ; fhir:Bundle.entry.resource <urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 13 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2" ] ; fhir:Bundle.entry.resource <urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 14 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca" ] ; fhir:Bundle.entry.resource <urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "Observation" ] ] ], [ fhir:index 15 ; fhir:Bundle.entry.fullUrl [ fhir:value "urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa" ] ; fhir:Bundle.entry.resource <urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa> ; fhir:Bundle.entry.request [ fhir:Bundle.entry.request.method [ fhir:value "POST" ] ; fhir:Bundle.entry.request.url [ fhir:value "DiagnosticReport" ] ] ] . <urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17> a fhir:Organization ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-1"] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Organization_Inline-Instance-for-oncology-report-example-1\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Organization Inline-Instance-for-oncology-report-example-1</b></p><a name=\"Inline-Instance-for-oncology-report-example-1\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-1\"> </a><p><b>identifier</b>: <code>http://example.org/genomics/NamingSystem/organization</code>/CEGAT</p><p><b>name</b>: CEGAT</p></div>" ] ; fhir:Organization.identifier [ fhir:index 0 ; fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/organization" ] ; fhir:Identifier.value [ fhir:value "CEGAT" ] ] ; fhir:Organization.name [ fhir:value "CEGAT"] . <urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648> a fhir:Patient ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-2"] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Patient_Inline-Instance-for-oncology-report-example-2\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Patient Inline-Instance-for-oncology-report-example-2</b></p><a name=\"Inline-Instance-for-oncology-report-example-2\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-2\"> </a><p style=\"border: 1px #661aff solid; background-color: #e6e6ff; padding: 10px;\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</p><hr/></div>" ] ; fhir:Patient.identifier [ fhir:index 0 ; fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/patID" ] ; fhir:Identifier.value [ fhir:value "11111" ] ] . <urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516> a fhir:Specimen ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-3"] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Specimen_Inline-Instance-for-oncology-report-example-3\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Specimen Inline-Instance-for-oncology-report-example-3</b></p><a name=\"Inline-Instance-for-oncology-report-example-3\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-3\"> </a><p><b>identifier</b>: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><p><b>type</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0487 TUMOR}\">Tumor</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><h3>Collections</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Method</b></td><td><b>BodySite</b></td></tr><tr><td style=\"display: none\">*</td><td><span title=\"Codes:\">Biopsy</span></td><td><span title=\"Codes:{http://hl7.org/fhir/sid/icd-10-cm C16.0}\">Malignant neoplasm of cardia</span></td></tr></table></div>" ] ; fhir:Specimen.identifier [ fhir:index 0 ; fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ; fhir:Specimen.type [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0487" ] ; fhir:Coding.code [ fhir:value "TUMOR" ] ; fhir:Coding.display [ fhir:value "Tumor" ] ] ] ; fhir:Specimen.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Specimen.collection [ fhir:Specimen.collection.method [ fhir:CodeableConcept.text [ fhir:value "Biopsy" ] ] ; fhir:Specimen.collection.bodySite [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://hl7.org/fhir/sid/icd-10-cm" ] ; fhir:Coding.code [ fhir:value "C16.0" ] ] ] ] . <urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-4"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-4\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-4</b></p><a name=\"Inline-Instance-for-oncology-report-example-4\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-4\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:8975}\">PIK3CA</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_006218.4:c.3140A>G}\">NM_006218.4:c.3140A>G</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NP_006209.2:p.His1047Arg}\">NP_006209.2:p.His1047Arg</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_006218.3}\">NM_006218.4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: A</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 64 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:8975" ] ; fhir:Coding.display [ fhir:value "PIK3CA" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_006218.4:c.3140A>G" ] ; fhir:Coding.display [ fhir:value "NM_006218.4:c.3140A>G" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48005-3 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48005-3" ] ; fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NP_006209.2:p.His1047Arg" ] ; fhir:Coding.display [ fhir:value "NP_006209.2:p.His1047Arg" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_006218.3" ] ; fhir:Coding.display [ fhir:value "NM_006218.4" ] ] ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "A" ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.2188"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 9 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "64"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-5"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-5\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-5</b></p><a name=\"Inline-Instance-for-oncology-report-example-5\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-5\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:7989}\">NRAS</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_002524.4:c.34G>T}\">NM_002524.4:c.34G>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_002524.4}\">NM_002524.4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1793 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 145 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:7989" ] ; fhir:Coding.display [ fhir:value "NRAS" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_002524.4:c.34G>T" ] ; fhir:Coding.display [ fhir:value "NM_002524.4:c.34G>T" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_002524.4" ] ; fhir:Coding.display [ fhir:value "NM_002524.4" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "C" ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.1793"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "145"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-6"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-6\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-6</b></p><a name=\"Inline-Instance-for-oncology-report-example-6\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-6\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:16712}\">FBXW7</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_001349798.2:c.1394G>A}\">NM_001349798.2:c.1394G>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NP_001336727.1:p.Arg465His}\">NP_001336727.1:p.Arg465His</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_001349798.2}\">NM_001349798.2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1053 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 57 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:16712" ] ; fhir:Coding.display [ fhir:value "FBXW7" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_001349798.2:c.1394G>A" ] ; fhir:Coding.display [ fhir:value "NM_001349798.2:c.1394G>A" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48005-3 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48005-3" ] ; fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NP_001336727.1:p.Arg465His" ] ; fhir:Coding.display [ fhir:value "NP_001336727.1:p.Arg465His" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_001349798.2" ] ; fhir:Coding.display [ fhir:value "NM_001349798.2" ] ] ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "C" ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.1053"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 9 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "57"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-7"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-7\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-7</b></p><a name=\"Inline-Instance-for-oncology-report-example-7\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-7\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:7133}\">KMT2D</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_003482.3:c.7900_7901delCA}\">NM_003482.3:c.7900_7901delCA</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:0000159}\">deletion</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_003482.3}\">NM_003482.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: CTG</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.188 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 117 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:7133" ] ; fhir:Coding.display [ fhir:value "KMT2D" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_003482.3:c.7900_7901delCA" ] ; fhir:Coding.display [ fhir:value "NM_003482.3:c.7900_7901delCA" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:0000159" ] ; fhir:Coding.display [ fhir:value "deletion" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_003482.3" ] ; fhir:Coding.display [ fhir:value "NM_003482.3" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "CTG" ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.188"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "117"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:58828523-8893-45fc-973b-16290366c5e5> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-8"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-8\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-8</b></p><a name=\"Inline-Instance-for-oncology-report-example-8\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-8\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:8975}\">PIK3CA</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_006218.3:c.333G>T}\">NM_006218.3:c.333G>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_006218.3}\">NM_006218.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1471 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 68 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:8975" ] ; fhir:Coding.display [ fhir:value "PIK3CA" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_006218.3:c.333G>T" ] ; fhir:Coding.display [ fhir:value "NM_006218.3:c.333G>T" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_006218.3" ] ; fhir:Coding.display [ fhir:value "NM_006218.3" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "G" ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.1471"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "68"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-9"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-9\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-9</b></p><a name=\"Inline-Instance-for-oncology-report-example-9\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-9\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:6126}\">IRS2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_003749.2:c.3960C>T}\">NM_003749.2:c.3960C>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_003749.2}\">NM_003749.2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1343 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 134 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:6126" ] ; fhir:Coding.display [ fhir:value "IRS2" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_003749.2:c.3960C>T" ] ; fhir:Coding.display [ fhir:value "NM_003749.2:c.3960C>T" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_003749.2" ] ; fhir:Coding.display [ fhir:value "NM_003749.2" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "G" ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.1343"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "134"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-10"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-10\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-10</b></p><a name=\"Inline-Instance-for-oncology-report-example-10\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-10\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:1787}\">CDKN2A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_000077.4:c.9_32del}\">NM_000077.4:c.9_32del</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:0000159}\">deletion</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NP_000068.1:p.Ala4_Pro11del}\">NP_000068.1:p.Ala4_Pro11del</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_000077.4}\">NM_000077.4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: AGGCTCCATGCTGCTCCCCGCCGCC</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.0536 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 112 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:1787" ] ; fhir:Coding.display [ fhir:value "CDKN2A" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_000077.4:c.9_32del" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:0000159" ] ; fhir:Coding.display [ fhir:value "deletion" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48005-3 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48005-3" ] ; fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NP_000068.1:p.Ala4_Pro11del" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_000077.4" ] ; fhir:Coding.display [ fhir:value "NM_000077.4" ] ] ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "AGGCTCCATGCTGCTCCCCGCCGCC" ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.0536"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 9 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "112"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-11"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-11\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-11</b></p><a name=\"Inline-Instance-for-oncology-report-example-11\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-11\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:9949}\">RECQL4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_004260.4:c.2086C>T}\">NM_004260.4:c.2086C>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NP_004251.4:p.Arg696Cys}\">NP_004251.4:p.Arg696Cys</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_004260.4}\">NM_004260.4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2568 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 148 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:9949" ] ; fhir:Coding.display [ fhir:value "RECQL4" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_004260.4:c.2086C>T" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48005-3 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48005-3" ] ; fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NP_004251.4:p.Arg696Cys" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_004260.4" ] ; fhir:Coding.display [ fhir:value "NM_004260.4" ] ] ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "G" ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.2568"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 9 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "148"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:c3587931-242f-4129-93f9-be24500c8f29> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-12"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-12\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-12</b></p><a name=\"Inline-Instance-for-oncology-report-example-12\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-12\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:10483}\">RYR1</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_000540.3:c.4964G>A}\">NM_000540.3:c.4964G>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NP_000531.2:p.Arg1655Leu}\">NP_000531.2:p.Arg1655Leu</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_000540.2}\">NM_000540.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: G</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2151 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 93 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:10483" ] ; fhir:Coding.display [ fhir:value "RYR1" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_000540.3:c.4964G>A" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48005-3 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48005-3" ] ; fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NP_000531.2:p.Arg1655Leu" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_000540.2" ] ; fhir:Coding.display [ fhir:value "NM_000540.3" ] ] ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "G" ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.2151"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 9 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "93"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-13"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-13\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-13</b></p><a name=\"Inline-Instance-for-oncology-report-example-13\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-13\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:10519}\">SACS</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_014363.5:c.12118G>A}\">NM_014363.5:c.12118G>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_014363.5}\">NM_014363.5</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.3333 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 60 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:10519" ] ; fhir:Coding.display [ fhir:value "SACS" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_014363.5:c.12118G>A" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_014363.5" ] ; fhir:Coding.display [ fhir:value "NM_014363.5" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "C" ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.3333"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "60"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-14"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-14\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-14</b></p><a name=\"Inline-Instance-for-oncology-report-example-14\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-14\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:11086}\">SLIT2</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_004787.3:c.1290C>A}\">NM_004787.3:c.1290C>A</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_004787.3}\">NM_004787.3</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.2642 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 53 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:11086" ] ; fhir:Coding.display [ fhir:value "SLIT2" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_004787.3:c.1290C>A" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_004787.3" ] ; fhir:Coding.display [ fhir:value "NM_004787.3" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "C" ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.2642"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "53"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca> a fhir:Observation ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-15"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/variant> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"Observation_Inline-Instance-for-oncology-report-example-15\"> </a><p class=\"res-header-id\"><b>Generated Narrative: Observation Inline-Instance-for-oncology-report-example-15</b></p><a name=\"Inline-Instance-for-oncology-report-example-15\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-15\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-variant.html\">Variant</a></p></div><p><b>status</b>: Final</p><p><b>category</b>: <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/observation-category laboratory}\">Laboratory</span>, <span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></p><p><b>subject</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-f7a438e6-f484-453d-97e8-aa4d51008648\">Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</a></p><p><b>effective</b>: 2023-03-05</p><p><b>performer</b>: <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></p><p><b>method</b>: <span title=\"Codes:{http://loinc.org LA26398-0}\">Sequencing</span></p><p><b>specimen</b>: Identifier: <code>http://example.org/genomics/NamingSystem/cegat/tissueID</code>/UNKNOWN</p><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48002-0}\">Genomic source class</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA6684-0}\">Somatic</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48018-6}\">Gene studied [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.genenames.org HGNC:11100}\">SMARCA4</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 62374-4}\">Human reference sequence assembly version</span></p><p><b>value</b>: <span title=\"Codes:{http://loinc.org LA14029-5}\">GRCh37</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48004-6}\">DNA change (c.HGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NM_003072.5:c.2372C>T}\">NM_003072.5:c.2372C>T</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48019-4}\">DNA change type</span></p><p><b>value</b>: <span title=\"Codes:{http://www.sequenceontology.org SO:1000002}\">substitution</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 48005-3}\">Amino acid change (pHGVS)</span></p><p><b>value</b>: <span title=\"Codes:{http://varnomen.hgvs.org NP_003063.2:p.Ala791Val}\">NP_003063.2:p.Ala791Val</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 51958-7}\">Transcript reference sequence [ID]</span></p><p><b>value</b>: <span title=\"Codes:{http://www.ncbi.nlm.nih.gov/refseq NM_003072.5}\">NM_003072.5</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 69547-8}\">Genomic ref allele [ID]</span></p><p><b>value</b>: C</p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 81258-6}\">Sample VAF</span></p><p><b>value</b>: 0.1938 relative frequency of a particular allele in the specimen<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote><blockquote><p><b>component</b></p><p><b>code</b>: <span title=\"Codes:{http://loinc.org 82121-5}\">Allelic read depth</span></p><p><b>value</b>: 160 reads per base pair<span style=\"background: LightGoldenRodYellow\"> (Details: UCUM code1 = '1')</span></p></blockquote></div>" ] ; fhir:Observation.status [ fhir:value "final"] ; fhir:Observation.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/observation-category" ] ; fhir:Coding.code [ fhir:value "laboratory" ] ] ], [ fhir:index 1 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:Observation.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69548-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69548-6" ] ; fhir:Coding.display [ fhir:value "Genetic variant assessment" ] ] ] ; fhir:Observation.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:Observation.effectiveDateTime [ fhir:value "2023-03-05"^^xsd:date] ; fhir:Observation.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:Observation.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA9633-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA9633-4" ] ; fhir:Coding.display [ fhir:value "Present" ] ] ] ; fhir:Observation.method [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA26398-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA26398-0" ] ; fhir:Coding.display [ fhir:value "Sequencing" ] ] ] ; fhir:Observation.specimen [ fhir:Reference.identifier [ fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/tissueID" ] ; fhir:Identifier.value [ fhir:value "UNKNOWN" ] ] ] ; fhir:Observation.component [ fhir:index 0 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48002-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48002-0" ] ; fhir:Coding.display [ fhir:value "Genomic source class" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA6684-0 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA6684-0" ] ; fhir:Coding.display [ fhir:value "Somatic" ] ] ] ], [ fhir:index 1 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48018-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48018-6" ] ; fhir:Coding.display [ fhir:value "Gene studied [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.genenames.org" ] ; fhir:Coding.code [ fhir:value "HGNC:11100" ] ; fhir:Coding.display [ fhir:value "SMARCA4" ] ] ] ], [ fhir:index 2 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:62374-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "62374-4" ] ; fhir:Coding.display [ fhir:value "Human reference sequence assembly version" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:LA14029-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "LA14029-5" ] ; fhir:Coding.display [ fhir:value "GRCh37" ] ] ] ], [ fhir:index 3 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48004-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48004-6" ] ; fhir:Coding.display [ fhir:value "DNA change (c.HGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NM_003072.5:c.2372C>T" ] ] ] ], [ fhir:index 4 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48019-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48019-4" ] ; fhir:Coding.display [ fhir:value "DNA change type" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.sequenceontology.org" ] ; fhir:Coding.code [ fhir:value "SO:1000002" ] ; fhir:Coding.display [ fhir:value "substitution" ] ] ] ], [ fhir:index 5 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:48005-3 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "48005-3" ] ; fhir:Coding.display [ fhir:value "Amino acid change (pHGVS)" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://varnomen.hgvs.org" ] ; fhir:Coding.code [ fhir:value "NP_003063.2:p.Ala791Val" ] ] ] ], [ fhir:index 6 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51958-7 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51958-7" ] ; fhir:Coding.display [ fhir:value "Transcript reference sequence [ID]" ] ] ] ; fhir:Observation.component.valueCodeableConcept [ fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://www.ncbi.nlm.nih.gov/refseq" ] ; fhir:Coding.code [ fhir:value "NM_003072.5" ] ; fhir:Coding.display [ fhir:value "NM_003072.5" ] ] ] ], [ fhir:index 7 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:69547-8 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "69547-8" ] ; fhir:Coding.display [ fhir:value "Genomic ref allele [ID]" ] ] ] ; fhir:Observation.component.valueString [ fhir:value "C" ] ], [ fhir:index 8 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:81258-6 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "81258-6" ] ; fhir:Coding.display [ fhir:value "Sample VAF" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "0.1938"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "relative frequency of a particular allele in the specimen" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ], [ fhir:index 9 ; fhir:Observation.component.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:82121-5 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "82121-5" ] ; fhir:Coding.display [ fhir:value "Allelic read depth" ] ] ] ; fhir:Observation.component.valueQuantity [ fhir:Quantity.value [ fhir:value "160"^^xsd:decimal ] ; fhir:Quantity.unit [ fhir:value "reads per base pair" ] ; fhir:Quantity.system [ fhir:value "http://unitsofmeasure.org" ] ; fhir:Quantity.code [ fhir:value "1" ] ] ] . <urn:uuid:6a80003f-822d-489e-8286-1f1dcba56dfa> a fhir:DiagnosticReport ; fhir:Resource.id [ fhir:value "Inline-Instance-for-oncology-report-example-16"] ; fhir:Resource.meta [ fhir:Meta.profile [ fhir:value "http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report" ; fhir:index 0 ; fhir:link <http://hl7.org/fhir/uv/genomics-reporting/StructureDefinition/genomic-report> ] ] ; fhir:DomainResource.text [ fhir:Narrative.status [ fhir:value "generated" ] ; fhir:Narrative.div "<div xmlns=\"http://www.w3.org/1999/xhtml\"><a name=\"DiagnosticReport_Inline-Instance-for-oncology-report-example-16\"> </a><p class=\"res-header-id\"><b>Generated Narrative: DiagnosticReport Inline-Instance-for-oncology-report-example-16</b></p><a name=\"Inline-Instance-for-oncology-report-example-16\"> </a><a name=\"hcInline-Instance-for-oncology-report-example-16\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\"/><p style=\"margin-bottom: 0px\">Profile: <a href=\"StructureDefinition-genomic-report.html\">Genomic Report</a></p></div><h2><span title=\"Codes:{http://loinc.org 51969-4}\">Genetic analysis report</span> (<span title=\"Codes:{http://terminology.hl7.org/CodeSystem/v2-0074 GE}\">Genetics</span>) </h2><table class=\"grid\"><tr><td>Subject</td><td>Anonymous Patient (no stated gender), DoB Unknown ( http://example.org/genomics/NamingSystem/cegat/patID#11111)</td></tr><tr><td>Reported</td><td>2019-09-15 11:35:05-0400</td></tr><tr><td>Performer</td><td> <a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-fc16d84c-8584-4e1d-baae-64e2f95bfe17\">Organization CEGAT</a></td></tr><tr><td>Identifier</td><td> <code>http://example.org/genomics/NamingSystem/cegat/reportID</code>/42867</td></tr></table><p><b>Report Details</b></p><table class=\"grid\"><tr><td><b>Code</b></td><td><b>Value</b></td><td><b>Flags</b></td><td><b>Relevant Time</b></td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-dac358c3-403a-4dbb-b478-4259aed882ae\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-1d773d66-cec7-44a2-b92a-46d00adeae00\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-842d9ab9-d940-4f0c-adf9-e5c528f5c0e5\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-9a9f9a4a-52e3-4738-bd0b-a25374bbf358\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-58828523-8893-45fc-973b-16290366c5e5\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-41bebbe5-e06f-4867-aa22-7c06db69dbd1\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-1642f190-e2c6-4999-8040-b9b2a70618bf\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-c3587931-242f-4129-93f9-be24500c8f29\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-41695fc0-1fd5-4cc8-95e6-82b2848a5cb6\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-58eb14f6-4059-4168-86a9-155ae61d30e2\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr><tr><td><a href=\"Bundle-bundle-oncology-report-example.html#urn-uuid-1a71e80f-b044-4a91-80e1-eadbe5a53dca\"><span title=\"Codes:{http://loinc.org 69548-6}\">Genetic variant assessment</span></a></td><td><span title=\"Codes:{http://loinc.org LA9633-4}\">Present</span></td><td>Final</td><td>2023-03-05</td></tr></table></div>" ] ; fhir:DiagnosticReport.identifier [ fhir:index 0 ; fhir:Identifier.system [ fhir:value "http://example.org/genomics/NamingSystem/cegat/reportID" ] ; fhir:Identifier.value [ fhir:value "42867" ] ] ; fhir:DiagnosticReport.status [ fhir:value "final"] ; fhir:DiagnosticReport.category [ fhir:index 0 ; fhir:CodeableConcept.coding [ fhir:index 0 ; fhir:Coding.system [ fhir:value "http://terminology.hl7.org/CodeSystem/v2-0074" ] ; fhir:Coding.code [ fhir:value "GE" ] ] ] ; fhir:DiagnosticReport.code [ fhir:CodeableConcept.coding [ fhir:index 0 ; a loinc:51969-4 ; fhir:Coding.system [ fhir:value "http://loinc.org" ] ; fhir:Coding.code [ fhir:value "51969-4" ] ; fhir:Coding.display [ fhir:value "Genetic analysis report" ] ] ] ; fhir:DiagnosticReport.subject [ fhir:Reference.reference [ fhir:value "urn:uuid:f7a438e6-f484-453d-97e8-aa4d51008648" ] ] ; fhir:DiagnosticReport.issued [ fhir:value "2019-09-15T11:35:05.722-04:00"^^xsd:dateTime] ; fhir:DiagnosticReport.performer [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:fc16d84c-8584-4e1d-baae-64e2f95bfe17" ] ] ; fhir:DiagnosticReport.specimen [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:a2041c83-b73d-4fc8-9466-4ba4a92da516" ] ] ; fhir:DiagnosticReport.result [ fhir:index 0 ; fhir:Reference.reference [ fhir:value "urn:uuid:dac358c3-403a-4dbb-b478-4259aed882ae" ] ], [ fhir:index 1 ; fhir:Reference.reference [ fhir:value "urn:uuid:1d773d66-cec7-44a2-b92a-46d00adeae00" ] ], [ fhir:index 2 ; fhir:Reference.reference [ fhir:value "urn:uuid:842d9ab9-d940-4f0c-adf9-e5c528f5c0e5" ] ], [ fhir:index 3 ; fhir:Reference.reference [ fhir:value "urn:uuid:9a9f9a4a-52e3-4738-bd0b-a25374bbf358" ] ], [ fhir:index 4 ; fhir:Reference.reference [ fhir:value "urn:uuid:58828523-8893-45fc-973b-16290366c5e5" ] ], [ fhir:index 5 ; fhir:Reference.reference [ fhir:value "urn:uuid:2c28b23f-3e9f-4c03-8c8f-0e76bc5dc9c2" ] ], [ fhir:index 6 ; fhir:Reference.reference [ fhir:value "urn:uuid:41bebbe5-e06f-4867-aa22-7c06db69dbd1" ] ], [ fhir:index 7 ; fhir:Reference.reference [ fhir:value "urn:uuid:1642f190-e2c6-4999-8040-b9b2a70618bf" ] ], [ fhir:index 8 ; fhir:Reference.reference [ fhir:value "urn:uuid:c3587931-242f-4129-93f9-be24500c8f29" ] ], [ fhir:index 9 ; fhir:Reference.reference [ fhir:value "urn:uuid:41695fc0-1fd5-4cc8-95e6-82b2848a5cb6" ] ], [ fhir:index 10 ; fhir:Reference.reference [ fhir:value "urn:uuid:58eb14f6-4059-4168-86a9-155ae61d30e2" ] ], [ fhir:index 11 ; fhir:Reference.reference [ fhir:value "urn:uuid:1a71e80f-b044-4a91-80e1-eadbe5a53dca" ] ] . # - ontology header ------------------------------------------------------------ <http://hl7.org/fhir/Bundle/bundle-oncology-report-example.ttl> a owl:Ontology ; owl:imports fhir:fhir.ttl ; owl:versionIRI <http://build.fhir.org/Bundle/bundle-oncology-report-example.ttl> .
IG © 2025+ HL7 International / Clinical Genomics. Package hl7.fhir.uv.genomics-reporting#4.0.0-cibuild based on FHIR 4.0.1. Generated 2026-09-21
Links: Table of Contents |
QA Report
| Version History |
|
Propose a change
