Clinical Genomics Resource Incubator, published by HL7 International / Clinical Genomics. This guide is not an authorized publication; it is the continuous build for version 0.1.0-ci-build built by the FHIR (HL7® FHIR® Standard) CI Build. This version is based on the current content of https://github.com/HL7/cg-incubator/ and changes regularly. See the Directory of published versions
: Molecular Definition Sequence 0 2B Concatenated
Raw ttl | Download
@prefix fhir: <http://hl7.org/fhir/> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
# - resource -------------------------------------------------------------------
a fhir:MolecularDefinition ;
fhir:resourceDefinition http://hl7.org/fhir/StructureDefinition/MolecularDefinition|0.1.0-ci-build ;
fhir:nodeRole fhir:treeRoot ;
fhir:id [ fhir:v "example-sequence0-2b-concatenated"] ; #
fhir:language [ fhir:v "en"] ; #
fhir:text [
fhir:status [ fhir:v "generated" ] ;
fhir:div [ fhir:v "<div xmlns=\"http://www.w3.org/1999/xhtml\" xml:lang=\"en\" lang=\"en\"><p class=\"res-header-id\"><b>Generated Narrative: MolecularDefinition example-sequence0-2b-concatenated</b></p><a name=\"example-sequence0-2b-concatenated\"> </a><a name=\"hcexample-sequence0-2b-concatenated\"> </a><div style=\"display: inline-block; background-color: #d9e0e7; padding: 6px; margin: 4px; border: 1px solid #8da1b4; border-radius: 5px; line-height: 60%\"><p style=\"margin-bottom: 0px\">Language: en</p></div><p><b>moleculeType</b>: <span title=\"Codes:{http://hl7.org/fhir/uv/cg-incubator/CodeSystem/moleculardefinition-moleculetype dna}\">DNA sequence</span></p><blockquote><p><b>representation</b></p><h3>Literals</h3><table class=\"grid\"><tr><td style=\"display: none\">-</td><td><b>Value</b></td></tr><tr><td style=\"display: none\">*</td><td>ATGAACAGACAAGTAAAAGACATGACAGYGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTC TTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAA GAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAG</td></tr></table></blockquote></div>"^^rdf:XMLLiteral ]
] ; #
fhir:moleculeType [
( fhir:coding [
fhir:system [
fhir:v "http://hl7.org/fhir/uv/cg-incubator/CodeSystem/moleculardefinition-moleculetype"^^xsd:anyURI ;
fhir:l <http://hl7.org/fhir/uv/cg-incubator/CodeSystem/moleculardefinition-moleculetype> ] ;
fhir:code [ fhir:v "dna" ] ;
fhir:display [ fhir:v "DNA sequence" ] ] )
] ; #
fhir:representation ( [
fhir:literal [
fhir:value [ fhir:v "ATGAACAGACAAGTAAAAGACATGACAGYGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTC TTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAA GAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAG" ] ]
] ) . #