This is the Continuous Integration Build of FHIR (will be incorrect/inconsistent at times).
See the Directory of published versions
Example MolecularDefinition/example-sequence0-2b-concatenated (Turtle)
Raw Turtle (+ also see Turtle/RDF Format Specification)
Simple Sequence example 0 to be concatenated
@prefix fhir: <http://hl7.org/fhir/> .
@prefix owl: <http://www.w3.org/2002/07/owl#> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
# - resource -------------------------------------------------------------------
<http://hl7.org/fhir/MolecularDefinition/example-sequence0-2b-concatenated> a fhir:MolecularDefinition ;
fhir:nodeRole fhir:treeRoot ;
fhir:id [ fhir:v "example-sequence0-2b-concatenated"] ; #
fhir:moleculeType [
fhir:coding ( [
fhir:system [ fhir:v "http://hl7.org/fhir/sequence-type"^^xsd:anyURI ] ;
fhir:code [ fhir:v "dna" ] ;
fhir:display [ fhir:v "DNA Sequence" ]
] )
] ; #
fhir:representation ( [
fhir:literal [
fhir:value [ fhir:v "ATGAACAGACAAGTAAAAGACATGACAGYGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTC TTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAA GAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAG" ]
]
] ) . #
# -------------------------------------------------------------------------------------
Usage note: every effort has been made to ensure that the
examples are correct and useful, but they are not a normative part
of the specification.